ZRdb KZFP & Repeats
...

LINE_X8_LINE

  • Name
    X8_LINE
  • Repbase
    X8_LINE
  • Type
    LINE
  • Emergence
    319.0 Mya
  • Dfam Id
    DF0001121
Description :

The non-autonomous CR1 element matches the same region of a CR1-typeLINE as does X1_LINE.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
gcaaaaaggaataatgagttaatgctagccaaagggattaaagggaataagaagggcttttacaaatatcagggaaaagaaatactagagagaaaatagggccactaataaatgaggaaagaaatgaaattaatgatgactctaaaatggctgagatactgaactcattttttaaatctgtctttaacaagaaaaataaagaaaagaaatttggacaattaggaagtaatgaagaccttgtaaaaatagctattgataaaaagcaggtaaagaatacttggaaaatttgaacaaat
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 6 99.0 Weakly correlated
2 ZNF263 4 180.0 Weakly correlated
3 ZFP69B 2 99.0 Weakly correlated
4 ZFP37 2 99.0 Weakly correlated
5 ZNF394 2 99.0 Weakly correlated
6 ZNF766 1 43.0 Weakly correlated
7 ZNF723 1 15.2 Weakly correlated
8 ZNF705D 1 28.9 Weakly correlated
9 ZNF705B 1 28.9 Weakly correlated
10 ZNF701 1 28.9 Weakly correlated
11 ZNF549 1 87.0 Weakly correlated
12 ZNF534 1 19.6 Weakly correlated
13 ZNF485 1 94.0 Weakly correlated
14 ZNF468 1 28.9 Weakly correlated
15 ZNF324 1 99.0 Weakly correlated
16 ZNF257 1 0.0 Weakly correlated
17 ZNF197 1 99.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF534 1 19.6 Weakly correlated
2 ZNF257 1 0.0 Weakly correlated
3 ZNF468 1 28.9 Weakly correlated
4 ZNF263 1 180.0 Weakly correlated
5 ZNF701 1 28.9 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats