ZRdb KZFP & Repeats
...

LINE_X5B_LINE

  • Name
    X5B_LINE
  • Repbase
    X5B_LINE
  • Type
    LINE
  • Emergence
    319.0 Mya
  • Dfam Id
    DF0001116
Description :

X5B_LINE is detected in all mammals and birds.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
gcagggaacaaaagggagagaacatattaaatggaacagtcatgcagcatactgaccaggaaagggatttaggggttattgtagaaaaatccttgaaactatcagtccagtgcatggctgcagtaaaaaaggcaaacaggatactggggtacgtcacccgtgggacagaaaatcagaagaagtga
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 4 99.0 Weakly correlated
2 ZNF18 2 160.0 Weakly correlated
3 ZNF793 2 99.0 Weakly correlated
4 ZFP37 1 99.0 Weakly correlated
5 ZKSCAN1 1 160.0 Weakly correlated
6 ZNF263 1 180.0 Weakly correlated
7 ZNF528 1 43.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF793 1 99.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats