ZRdb KZFP & Repeats
...

LINE_X1_LINE

  • Name
    X1_LINE
  • Repbase
    X1_LINE
  • Type
    LINE
  • Emergence
    319.0 Mya
  • Dfam Id
    DF0001113
Description :

X1_LINE dispersed before mammalian diversification. It has similarityto a CR1 element ORF; however the 5' end is low complexity and purine-rich. It may be that this is a CR1-derived SINE.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
ataatacaccagancntatgaggaaaatgaagggaaatggaggtgnaaaaagaaatgtatgaagaaaggacacagaggggaaatggaaagtgttcaaagataaattaatgtatgcccaagggttatgcgtgccatctagcaataaatacgctagaagtaaaaatgaaggccaatgcggatgaacgaggaagtgcaaaaagtaatcaagggtaagaaagaggcatatgcgaggtataaagcatcaggtacaagggagagctggnaagattacagaatgaagttaagagagtgtaaaaaaatgataagaaaagcaaaggtggagaatgaaaggaagattgcacgagaggttaagataaataataaggcgtttttcaagtacataaggaacaagaggtcagcgaaggagacggcagggcctctaagagatggcaagggtaatttattgacagaagaggtagacattgctaaaaaattaaatgaattctttgcctcagtgttcacaaaggaggatgggggacagatgccagaaacagacatanatttcccaggggaggaaaaagaaatactgaaggaaatcaggatcgtgccagaacaggtgatcaagaaattagaacatctgaagnctganagaaccccaggncagga
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF175 3 94.0 Weakly correlated
2 ZKSCAN1 2 160.0 Weakly correlated
3 ZKSCAN8 2 160.0 Weakly correlated
4 ZNF197 2 99.0 Weakly correlated
5 ZNF584 2 99.0 Weakly correlated
6 ZNF589 2 28.9 Weakly correlated
7 ZNF766 2 43.0 Weakly correlated
8 ZNF92 1 28.9 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF175 2 94.0 Weakly correlated
2 ZNF584 1 99.0 Weakly correlated
3 ZNF197 1 99.0 Weakly correlated
4 ZNF589 1 28.9 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats