ZRdb KZFP & Repeats
...

LTR_UCON51

  • Name
    UCON51
  • Repbase
    UCON51
  • Type
    LTR
  • Emergence
    319.0 Mya
  • Dfam Id
    DF0001186
Description :

Typical TG..CA termini of LTRs and a clear 5 bp TSD suggest either anERVL or Gypsy LTR. But 250 bp is a bit short and there is also not anobvious poly A site.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgctgcgtctgccaaccggtggccagacactagagcagacttaaccaattagcggagtcccccatccggtggctggactcgctgtgtgtgcgtcctgcacattaccgcagccgaggctcgaaccgggncccttgnggtccncgggcagcagctctaccaggtgagccaaaagggagcctccccctggccgagccggtaggagctgcgctaagctcgtctcagctggaagtcgctcttcgcatatcttnca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 9 99.0 Weakly correlated
2 ZNF610 3 28.9 Weakly correlated
3 ZNF394 2 99.0 Weakly correlated
4 ZNF479 1 6.4 Weakly correlated
5 ZNF93 1 8.6 Weakly correlated
6 ZNF705D 1 28.9 Weakly correlated
7 ZNF705B 1 28.9 Weakly correlated
8 ZNF701 1 28.9 Weakly correlated
9 ZNF563 1 28.9 Weakly correlated
10 ZNF530 1 28.9 Weakly correlated
11 ZNF519 1 19.6 Weakly correlated
12 RBAK 1 99.0 Weakly correlated
13 ZNF324 1 99.0 Weakly correlated
14 ZNF2 1 99.0 Weakly correlated
15 ZNF257 1 0.0 Weakly correlated
16 ZNF169 1 94.0 Weakly correlated
17 ZNF101 1 43.0 Weakly correlated
18 ZFP37 1 99.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF2 1 99.0 Weakly correlated
2 ZNF530 1 28.9 Weakly correlated
3 ZNF610 1 28.9 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats