ZRdb KZFP & Repeats
...

LTR_PRIMLTR79

  • Name
    PRIMLTR79
  • Repbase
    PrimLTR79
  • Type
    LTR
  • Emergence
    74.0 Mya
  • Dfam Id
    DF0001056
Description :

Renamed to PrimLTR79 since the original name of LTR79 was already taken.This is related to LTR31 and LTR26.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtaaccgagcctatattataaaaatcataagatgtttgttttacttattttcctttctctttgtccttttcttcctccatgcatgattgcttgcacgtagtcatttcggtagagggtagtcactaataattgattaacttcatatcctaacccccgggggctgcccgcaagattaatgaacttgtttttcttttaaagaacaatgatccttaggtcatgcagacctccttgatggcatccagaagtttgatcaggnccgncgnncgngccgagggacgcaagcagctttgatcatcgggggatctcacctcccgcatacctaccttactcataaaagcccccagttatgttcaaaggcaggtcggatttgagagtttgcctctcccgccctctcgctttggccaaatcgaataaacctttctctgctcctaagcgctgatgtgtcagtgtttggcttactgcgcatcgggtacncgaacctaaattttggggttctacaaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 15 99.0 Weakly correlated
2 ZNF394 9 99.0 Weakly correlated
3 ZNF2 6 99.0 Weakly correlated
4 ZFP37 6 99.0 Weakly correlated
5 ZNF766 5 43.0 Weakly correlated
6 ZNF610 4 28.9 Weakly correlated
7 ZNF101 4 43.0 Weakly correlated
8 ZNF468 4 28.9 Weakly correlated
9 ZNF558 3 99.0 Weakly correlated
10 ZNF792 3 94.0 Weakly correlated
11 ZNF18 3 160.0 Weakly correlated
12 ZNF263 3 180.0 Weakly correlated
13 ZNF324 3 99.0 Weakly correlated
14 ZNF793 2 99.0 Weakly correlated
15 ZNF554 2 99.0 Weakly correlated
16 ZNF528 2 43.0 Weakly correlated
17 ZNF707 2 74.0 Highly correlated
18 ZNF264 2 99.0 Weakly correlated
19 ZFP69B 2 99.0 Weakly correlated
20 ZNF701 1 28.9 Weakly correlated
21 ZNF778 1 74.0 Highly correlated
22 ZNF695 1 28.9 Weakly correlated
23 ZNF441 1 43.0 Weakly correlated
24 ZNF597 1 94.0 Weakly correlated
25 ZNF589 1 28.9 Weakly correlated
26 ZNF584 1 99.0 Weakly correlated
27 ZNF534 1 19.6 Weakly correlated
28 ZNF429 1 28.9 Weakly correlated
29 ZNF317 1 99.0 Weakly correlated
30 ZNF30 1 94.0 Weakly correlated
31 ZNF28 1 28.9 Weakly correlated
32 ZNF141 1 43.0 Weakly correlated
33 ZFP57 1 87.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF766 3 43.0 Weakly correlated
2 ZNF792 2 94.0 Weakly correlated
3 ZNF534 1 19.6 Weakly correlated
4 ZNF101 1 43.0 Weakly correlated
5 ZNF793 1 99.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats