ZRdb KZFP & Repeats
...

LTR_PRIMA4_LTR

  • Name
    PRIMA4_LTR
  • Repbase
    PRIMA4_LTR
  • Type
    LTR
  • Emergence
    74.0 Mya
  • Dfam Id
    DF0001054
Description :

PRIMA4_LTR is the long terminal repeat for the PRIMA4 endogenousretrovirus. The internal part of PRIMA4 is PRIMA4-int. PRIMA4 isrelated to the Class I retroviruses, including leukemia viruses. SoloLTRs are flanked by 4bp TSDs.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtgaaaggaaattaaatcttgggaccccaaactcattnagccaaagggaaaagtcaagctgggaactgggtcacgcaaacctgcctcccccttttggttcctaaataagatggctacaagatgaaaagctacacgcctcccccatattttgcccacaaggaaattcctagtgagctgttaaaatttcaccatggcaatgtaaattgatagcttatctttacaggtgcagtcaccccngcccaccagacacaaatgcatatctgattgttcccctgccccattttgtctgtgttatcttatgtaaaatgcagattccccgcatttttcctctgccccntttgtctatgtcatcttatgtaaaaaatgcagattcactgagccagacaaaggcatgaatgactatttttccctacccccctcttacatgaaaattgtgtacttctcaatatcccgccctttcccctttaaatttggagccctcaaaatcatcttcggagaaaggcatagacctgtctcccgggcgcgtccttaactttggcaaataaacctcctaaaatgattgagacttgtctcgtcatttttctcgattgaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF766 19 43.0 Weakly correlated
2 ZNF479 17 6.4 Weakly correlated
3 ZNF197 4 99.0 Weakly correlated
4 ZNF506 4 28.9 Weakly correlated
5 ZNF589 4 28.9 Weakly correlated
6 ZNF175 3 94.0 Weakly correlated
7 ZIM3 2 87.0 Weakly correlated
8 ZNF28 2 28.9 Weakly correlated
9 ZNF679 2 28.9 Weakly correlated
10 ZNF878 1 43.0 Weakly correlated
11 ZFP37 1 99.0 Weakly correlated
12 ZNF84 1 99.0 Weakly correlated
13 ZNF816 1 28.9 Weakly correlated
14 ZNF793 1 99.0 Weakly correlated
15 ZNF597 1 94.0 Weakly correlated
16 ZNF584 1 99.0 Weakly correlated
17 ZNF582 1 99.0 Weakly correlated
18 ZNF534 1 19.6 Weakly correlated
19 ZNF425 1 94.0 Weakly correlated
20 ZNF394 1 99.0 Weakly correlated
21 ZNF382 1 99.0 Weakly correlated
22 ZNF324 1 99.0 Weakly correlated
23 ZNF18 1 160.0 Weakly correlated
24 ZKSCAN1 1 160.0 Weakly correlated
25 ZFP69B 1 99.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF479 16 6.4 Weakly correlated
2 ZNF766 6 43.0 Weakly correlated
3 ZNF506 4 28.9 Weakly correlated
4 ZNF197 3 99.0 Weakly correlated
5 ZIM3 1 87.0 Weakly correlated
6 ZNF425 1 94.0 Weakly correlated
7 ZNF793 1 99.0 Weakly correlated
8 ZNF597 1 94.0 Weakly correlated
9 ZNF589 1 28.9 Weakly correlated
10 ZNF816 1 28.9 Weakly correlated
11 ZNF175 1 94.0 Weakly correlated
12 ZNF28 1 28.9 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats