ZRdb KZFP & Repeats
...

LTR_MLT1E

  • Name
    MLT1E
  • Repbase
    MLT1E
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0001005
Description :

MLT1E (Mammalian LTR Transposon) has 5 bp TSDs. Note that a full-lengthERV-MaLR (Mammalian apparent LTR retrotransposon) element is derivedfrom an ERV (Endogenous Retrovirus), but only contains the Gag gene(that is, no Pol or Env).
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtggtaggcagaattctaagatggcccccaagattcccgccccctggtgtacacgccctgtataatcccctccccttgagtgtgggcgggacctgtgaatatgatgggatntcactcccgtgattaggttacgttatatggcaaaggtgaagggattttgcagatgtaattaaggtccctaatcagttgactttgagttaatcaaaagggagattatcctgggtgggcctgacctaatcaggtgagccctttaaaagagggtctagaggtcagagacggaagaagtcagagagattcgaagcagcagagacgctctcctgctggccttgaagaagcaaactgccatgttgtggagagggccacgtggcagggaacggcgggcggcctctaggagctgagggcctcagtcctacaaccgcaaggaactgaattctgccaacaaccagtgagcttggaagaggaccccgagcctcagatgagaccgcagccccggccgacaccttgatttcagcctngtgagaccctgagcagaggacccagctaagccgtgcccggactcctgacccacggaaactgtgagataataaatgtgtgttgttttaagccgctaagtttgtggtaatttgttacgcagcaatagaaaactaataca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF584 4 99.0 Highly correlated
2 ZIM3 2 87.0 Moderately correlated
3 ZNF251 1 94.0 Moderately correlated
4 ZNF28 1 28.9 Weakly correlated
5 ZNF317 1 99.0 Highly correlated
6 ZNF479 1 6.4 Weakly correlated
7 ZNF486 1 8.6 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZIM3 1 87.0 Moderately correlated
2 ZNF251 1 94.0 Moderately correlated
3 ZNF28 1 28.9 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats