ZRdb KZFP & Repeats
...

LTR_MLT1-INT

  • Name
    MLT1-INT
  • Repbase
    MLT1_I
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0001132
Description :

Note that a full-length ERV-MaLR (Mammalian apparent LTRretrotransposon) element is derived from an ERV (Endogenous Retrovirus),but only contains the Gag gene (that is, no Pol or Env).
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
gattttggtaccgggaagtggggtgctgctgtaacaaatacctaaaaatgtggaagtggctttggaactgggtaatgggtagaggctggaagagttttgaggcgcatgatagaaaaagcctagattgccttgaagagactgttggtagaaatatggacgttaaaggcgattctggtgagggctcagaaggaaatgaggagagctgtagagaaagcttctatcgtcttagagaatacatanatcgtcatgaacagaatgttggtagaaatatggacgttaaaggcgcttctggtgaggtctcagacggaaatgaggaacatgttattggaaactggaggaaaggcgatccttgttataaagtggcagagaacttggctgaattgtgttctagtgttntgtggaaagtagaacttgtaagcgatgaacttggatatttagctgaggagatttctaagcaaagtgttgaaggtgcggcctggtttctccttgctgcttatagtaaaatgcgagaggaaagagataaattgaggaaggaactgttaagcaaaaaggaaccagaacttgangatttggaaaattctcagcctatccanattgcaaaaaatgagaaagcgtgctctggagagaacgccaagggtgtggctggacaaccatttgntaaagagattaggcgtgtgactcatggatccaatcagccatctcagcagaagccaggaatagagatgggattatccaggaaggatctgtggaggaccctcttgtctaatggcgtggacccccgtgacntncacgggaggccgacaaggtttttgagaatnttataccagcagaaacactgccagcttggactgaaggggacagagatgggacgaaatgaaggaaggatgactctgagggcggagccacggatgcagaggccatgggggctgnntcnntggcagagcatggggccgccccagcgggcccggagggcagagcatcgagccanagaggattattctcaggccttgaaacctaatggaatttgccctgctgggtttcggacttgcttgggacccgtgacccctttnttccttccgatttctcccttttggaatgggaatgtctatcctatgcctgtcccaccattgtattttggaagcagataacttgttttctagtttcacaggttcacagatggagaggaattttgccccaggatgaatcatacccngagtctcacccatacctgatttagatgatatttagatgagattttggacttagagttgatgctggaatgggttaagactttttgggggatgttgggatggggtgaatgtattttgcacgtgggaaggacgtgaanttttggggggccagagggcggac
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF766 4 43.0 Weakly correlated
2 ZNF707 4 74.0 Weakly correlated
3 ZNF584 4 99.0 Highly correlated
4 ZIM3 3 87.0 Moderately correlated
5 ZNF317 3 99.0 Highly correlated
6 ZNF382 2 99.0 Highly correlated
7 ZNF425 2 94.0 Moderately correlated
8 ZNF679 2 28.9 Weakly correlated
9 ZNF589 2 28.9 Weakly correlated
10 ZNF534 2 19.6 Weakly correlated
11 ZNF92 1 28.9 Weakly correlated
12 ZFP37 1 99.0 Highly correlated
13 ZNF723 1 15.2 Weakly correlated
14 ZNF705B 1 28.9 Weakly correlated
15 ZNF506 1 28.9 Weakly correlated
16 ZNF490 1 43.0 Weakly correlated
17 ZNF480 1 43.0 Weakly correlated
18 ZNF440 1 28.9 Weakly correlated
19 ZNF394 1 99.0 Highly correlated
20 ZNF324 1 99.0 Highly correlated
21 ZNF2 1 99.0 Highly correlated
22 ZNF28 1 28.9 Weakly correlated
23 ZNF26 1 99.0 Highly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZIM3 2 87.0 Moderately correlated
2 ZNF707 2 74.0 Weakly correlated
3 ZNF440 1 28.9 Weakly correlated
4 ZNF28 1 28.9 Weakly correlated
5 ZNF534 1 19.6 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats