ZRdb KZFP & Repeats
...

LTR_MER9B

  • Name
    MER9B
  • Repbase
    MER9B
  • Type
    LTR
  • Emergence
    28.9 Mya
  • Dfam Id
    DF0000972
Description :

MER9B is a long terminal repeat of the HERVK9 endogenous retrovirus.Note that MER stands for MEdium Reiteration frequency interspersedrepeat. As such, MERs as a group are a grab bag of DNA transposons andretrotransposons.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgctggnagcaagccctaagcctgtcataaacaggccttaaagaaactggccataaacaggatttctgcagcaatgtgacatgctcgtgatggctatcacgcacactgctagaagttgttggtttactggagcagggcaaggaacacctggcccgcccggagcggaaaactgctcaaaccacaaacaatagcaggagcggcctgtgccttaacaacatgtttttgctgcagataatcagccagagcctgtttctctgctcctcgctaagaatgctttgtttcccgtaaggaatgcttttagctaatctataatctatagaaacaatgcttatcactggcttnctgtcaataaatatgtgggtcaaactctgttcgtggctctcagctctgaaggctgtcagccccctgattcccactttgcactctatttctgtgtctttgtctttaattcctctagcgccgctgggttagggtctccacgaccgagctggtctcggca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF320 10 28.9 Highly correlated
2 ZNF28 3 28.9 Highly correlated
3 ZNF417 2 28.9 Highly correlated
4 ZNF680 2 28.9 Highly correlated
5 ZNF766 2 43.0 Weakly correlated
6 ZNF816 2 28.9 Highly correlated
7 ZKSCAN8 1 160.0 Weakly correlated
8 ZNF157 1 99.0 Weakly correlated
9 ZNF18 1 160.0 Weakly correlated
10 ZNF587 1 28.9 Highly correlated
11 ZNF701 1 28.9 Highly correlated
12 ZNF761 1 19.6 Moderately correlated
13 ZNF92 1 28.9 Highly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF320 4 28.9 Highly correlated
2 ZNF680 1 28.9 Highly correlated
3 ZNF816 1 28.9 Highly correlated
4 ZNF417 1 28.9 Highly correlated
5 ZNF761 1 19.6 Moderately correlated
6 ZNF766 1 43.0 Weakly correlated
7 ZNF92 1 28.9 Highly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats