ZRdb KZFP & Repeats
...

LTR_MER95

  • Name
    MER95
  • Repbase
    MER95
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000961
Description :

MER95 has 4 bp TSDs, and is distantly related to LTR109A2. Note thatMER stands for MEdium Reiteration frequency interspersed repeat. Assuch, MERs as a group are a grab bag of DNA transposons andretrotransposons.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgttnaagaaaataaaaatggaggccacagtttagatataccccaaggccaaccgcccatagccacgtagccaaaacttaagtcatcctgatttccccgaaacgctagctctaatcataaacgaaacacaaaacgtaagctttacgtccttgtcagcatgattcagtgaaattaaaccaatcagctatagacaaatcagcttaaacagctctgcttgccttaaaaagaatgttaatgtataacagccaatcacgaaaaaggtcaaaatacttcctcctttatgctttataaactgtgctgtaactgctgtaagnngagcttcttaccactttcggtttgaggtctcccggttcgcgaactgttctttnnnncgntgtatgcacaataaactttaaaatttttcctaacttgatctgattttatttttgaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 9 99.0 Highly correlated
2 ZNF766 5 43.0 Weakly correlated
3 ZNF317 5 99.0 Highly correlated
4 ZFP37 4 99.0 Highly correlated
5 ZNF101 2 43.0 Weakly correlated
6 ZNF175 2 94.0 Moderately correlated
7 ZNF2 2 99.0 Highly correlated
8 ZNF778 1 74.0 Weakly correlated
9 ZNF75D 1 94.0 Moderately correlated
10 ZNF723 1 15.2 Weakly correlated
11 ZNF589 1 28.9 Weakly correlated
12 ZNF584 1 99.0 Highly correlated
13 ZNF263 1 180.0 Weakly correlated
14 ZNF248 1 99.0 Highly correlated
15 ZNF18 1 160.0 Weakly correlated
16 ZNF140 1 99.0 Highly correlated
17 ZKSCAN8 1 160.0 Weakly correlated
18 ZKSCAN1 1 160.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF75D 1 94.0 Moderately correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats