ZRdb KZFP & Repeats
...

LTR_MER92D

  • Name
    MER92D
  • Repbase
    No find
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000957
Description :

Note that MER stands for MEdium Reiteration frequency interspersedrepeat. As such, MERs as a group are a grab bag of DNA transposons andretrotransposons.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgacaatgttgaactttacctgagccctgtgctcccggaaagcagcgacggttaagaaatccccccacccttttgtgttccgggaaacggctaaccgcaaaggaccaccctgccctcgcatattccgagataagacccgtctccatccttcctcatgactcccataagactcgcgatgactcccttgtttacctgcctctataaaaccccaggcccccttccttttctttgagacgttcctcattaatgaacgttctccctattgcaatagcctgaataaaatcatctccttaattgtccggtgcattttgtctttcaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 6 99.0 Highly correlated
2 ZNF169 3 94.0 Moderately correlated
3 ZNF18 2 160.0 Weakly correlated
4 ZNF251 2 94.0 Moderately correlated
5 ZNF263 2 180.0 Weakly correlated
6 ZNF394 2 99.0 Highly correlated
7 ZNF75D 2 94.0 Moderately correlated
8 ZNF682 2 28.9 Weakly correlated
9 ZNF679 2 28.9 Weakly correlated
10 ZNF793 1 99.0 Highly correlated
11 ZNF723 1 15.2 Weakly correlated
12 ZNF705D 1 28.9 Weakly correlated
13 ZNF701 1 28.9 Weakly correlated
14 ZNF680 1 28.9 Weakly correlated
15 ZNF597 1 94.0 Moderately correlated
16 ZNF585A 1 99.0 Highly correlated
17 ZNF506 1 28.9 Weakly correlated
18 ZNF490 1 43.0 Weakly correlated
19 ZNF485 1 94.0 Moderately correlated
20 ZNF44 1 43.0 Weakly correlated
21 ZNF317 1 99.0 Highly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF75D 1 94.0 Moderately correlated
2 ZNF44 1 43.0 Weakly correlated
3 ZNF317 1 99.0 Highly correlated
4 ZNF723 1 15.2 Weakly correlated
5 ZNF490 1 43.0 Weakly correlated
6 ZNF506 1 28.9 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats