ZRdb KZFP & Repeats
...

LTR_MER92C

  • Name
    MER92C
  • Repbase
    MER92C
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000956
Description :

MER92C has 4 bp TSDs. Note that MER stands for MEdium Reiterationfrequency interspersed repeat. As such, MERs as a group are a grab bagof DNA transposons and retrotransposons.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgacaatgttgaactttacctgagccctgtgctcccggaaaacagcgacggttaagaaatccccccaaccttttgttttccgaaatccccccacccttttgtgttccgggaaatggcttaccgcaaagaaccacccttccccatatgacttagataagactcgctgtccactctttctcatgactcccgtaagactcgcggatgactcccttgtttacctgtgacaaggccaaacacagacctttccccttttgcctgaacctgctgacaaggccagacacagaccctccaacttcccgttctttgtctcatgaatgattagctgagattagaactgtttgtccccctgaaactagctagacacagagataaacatttcctgttcagctaactgactgagacttcccctgattgcaaaacaatcccaactgtaaatcaccccacctgtaacttgtctactcctccctataaaagtctaaggcaaaaccaccctgccgagacactctgatcttcggatctggggtgctctccctattgcaatagcctgaataaaatcaatctccttacttgttcggtttttgtctttgaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF766 16 43.0 Weakly correlated
2 ZNF263 9 180.0 Weakly correlated
3 ZNF589 9 28.9 Weakly correlated
4 ZKSCAN8 7 160.0 Weakly correlated
5 ZNF175 6 94.0 Moderately correlated
6 ZNF197 5 99.0 Highly correlated
7 ZNF584 5 99.0 Highly correlated
8 ZKSCAN1 3 160.0 Weakly correlated
9 ZFP37 3 99.0 Highly correlated
10 ZNF394 3 99.0 Highly correlated
11 ZNF614 2 99.0 Highly correlated
12 ZNF597 2 94.0 Moderately correlated
13 ZNF716 2 19.6 Weakly correlated
14 ZNF75D 2 94.0 Moderately correlated
15 ZNF382 2 99.0 Highly correlated
16 ZNF324 2 99.0 Highly correlated
17 ZNF2 2 99.0 Highly correlated
18 ZNF816 1 28.9 Weakly correlated
19 ZNF679 1 28.9 Weakly correlated
20 ZNF92 1 28.9 Weakly correlated
21 ZNF610 1 28.9 Weakly correlated
22 ZNF558 1 99.0 Highly correlated
23 ZNF485 1 94.0 Moderately correlated
24 ZNF251 1 94.0 Moderately correlated
25 ZNF18 1 160.0 Weakly correlated
26 ZNF101 1 43.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF263 4 180.0 Weakly correlated
2 ZNF589 3 28.9 Weakly correlated
3 ZNF175 3 94.0 Moderately correlated
4 ZNF197 2 99.0 Highly correlated
5 ZNF716 2 19.6 Weakly correlated
6 ZNF766 2 43.0 Weakly correlated
7 ZFP37 1 99.0 Highly correlated
8 ZNF584 1 99.0 Highly correlated
9 ZNF816 1 28.9 Weakly correlated
10 ZNF597 1 94.0 Moderately correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats