ZRdb KZFP & Repeats
...

LTR_MER92A

  • Name
    MER92A
  • Repbase
    MER92A
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000954
Description :

MER92A has 4 bp TSDs, and is distantly related to MER67D. Note that MERstands for MEdium Reiteration frequency interspersed repeat. As such,MERs as a group are a grab bag of DNA transposons and retrotransposons.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgaccaagtgttcacagttgcccatttcttaccctctgctttgtcttgaccaaactttagtcaggcttctctccttcctacaggcccctgaactctgcttgcccccaagcctgagcaagcactaaaatgcggaacgtgccccccttancagcttntcctgagaatcggctgaccacagcgagacacatttcctgtcagaccccaccggtcatgctgtctgctcgntccccctcgcttgcccantntcccctttctgctagttctgcttacccctccctataaaagaaaagcctttttctgtttgattttgagacgcttgcagattcctgagatcggagcgttctccctattgcaatagtctttttgaataaagtctctccttatctaagtccggatttgtttttatttgaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF766 6 43.0 Weakly correlated
2 ZNF175 5 94.0 Moderately correlated
3 ZNF589 4 28.9 Weakly correlated
4 ZNF584 4 99.0 Highly correlated
5 ZKSCAN8 3 160.0 Weakly correlated
6 ZNF479 3 6.4 Weakly correlated
7 ZIM3 2 87.0 Moderately correlated
8 ZNF263 1 180.0 Weakly correlated
9 ZNF382 1 99.0 Highly correlated
10 ZNF394 1 99.0 Highly correlated
11 ZNF197 1 99.0 Highly correlated
12 ZNF534 1 19.6 Weakly correlated
13 ZNF18 1 160.0 Weakly correlated
14 ZKSCAN1 1 160.0 Weakly correlated
15 ZNF597 1 94.0 Moderately correlated
16 ZNF680 1 28.9 Weakly correlated
17 ZNF705B 1 28.9 Weakly correlated
18 ZNF705D 1 28.9 Weakly correlated
19 ZNF730 1 19.6 Weakly correlated
20 ZFP37 1 99.0 Highly correlated
21 ZNF823 1 43.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF584 1 99.0 Highly correlated
2 ZNF263 1 180.0 Weakly correlated
3 ZNF175 1 94.0 Moderately correlated
4 ZNF589 1 28.9 Weakly correlated
5 ZNF823 1 43.0 Weakly correlated
6 ZNF534 1 19.6 Weakly correlated
7 ZNF197 1 99.0 Highly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats