ZRdb KZFP & Repeats
...

LTR_MER88

  • Name
    MER88
  • Repbase
    MER88
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000946
Description :

MER88 has 5 bp TSDs. It belongs to a group that includes MER73, MER74,MER54 and LTR53. MER88 was originally presented in the oppositeorientation. Note that MER stands for MEdium Reiteration frequencyinterspersed repeat. As such, MERs as a group are a grab bag of DNAtransposons and retrotransposons.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtattgtaaatttttaaaacttcatattttcctgatgcctcaacatccccacaaacaggctgtgagcaccccgcccaggtgaccaggtgcaccagtgtgataaggctggtccctgccacaagttccccttcttgccctcccctgactgtgacctagtgacattcaaacgcaccagtgaaatcccctcacgccttttgcttgtgtactccaccctgacccccaataaaggcacttgcccacgggtcctctctctctcggctccccacctgcttggttgagcccgctccctnggngctcctcccatgtggccccctgcgtggcgtgccgtgcctccctctctaggacctgtgagtataataaatcctttantttcntgtgcctctccgagtgtaatttccacggccgtgttggagtgatccttaaagaccccacaagggggacttactcccccatttacaacaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 14 99.0 Highly correlated
2 ZNF766 7 43.0 Weakly correlated
3 ZFP37 6 99.0 Highly correlated
4 ZNF324 6 99.0 Highly correlated
5 ZFP69B 5 99.0 Highly correlated
6 ZNF2 5 99.0 Highly correlated
7 ZNF263 4 180.0 Weakly correlated
8 ZNF320 4 28.9 Weakly correlated
9 ZNF197 3 99.0 Highly correlated
10 ZNF584 3 99.0 Highly correlated
11 ZNF418 2 43.0 Weakly correlated
12 ZNF701 2 28.9 Weakly correlated
13 ZNF610 2 28.9 Weakly correlated
14 ZNF589 2 28.9 Weakly correlated
15 ZNF534 2 19.6 Weakly correlated
16 ZNF425 2 94.0 Moderately correlated
17 ZNF394 2 99.0 Highly correlated
18 ZNF18 1 160.0 Weakly correlated
19 ZNF114 1 28.9 Weakly correlated
20 ZNF37A 1 99.0 Highly correlated
21 ZNF141 1 43.0 Weakly correlated
22 ZNF175 1 94.0 Moderately correlated
23 ZNF674 1 99.0 Highly correlated
24 ZNF28 1 28.9 Weakly correlated
25 ZNF705B 1 28.9 Weakly correlated
26 ZNF75A 1 94.0 Moderately correlated
27 ZNF101 1 43.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF263 3 180.0 Weakly correlated
2 ZNF584 2 99.0 Highly correlated
3 ZNF382 2 99.0 Highly correlated
4 ZNF589 2 28.9 Weakly correlated
5 ZNF320 2 28.9 Weakly correlated
6 ZNF534 2 19.6 Weakly correlated
7 ZNF197 1 99.0 Highly correlated
8 ZNF175 1 94.0 Moderately correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats