ZRdb KZFP & Repeats
...

LTR_MER87

  • Name
    MER87
  • Repbase
    MER87
  • Type
    LTR
  • Emergence
    43.0 Mya
  • Dfam Id
    DF0000944
Description :

MER87 has 4 bp TSDs. Note that MER stands for MEdium Reiterationfrequency interspersed repeat. As such, MERs as a group are a grab bagof DNA transposons and retrotransposons.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtaacagtgaaaggaggcctagcatgactgactccattttgctcctaaccccccgcggtgatatcttttaggttaactgcttttgcttatctctgcacgtaggccaagctaactatgggaggaatttagtttatagtttaactttaaaaaggatgataatagtcccttcccnaaactaacccccgaggagataaggagggtgtacacacaagtaacaatgttatgttaaagatttataggagcattgtgacctgaccaaggacaaagaagtttcgcnanctcctcggaccctcgctgncgcccagatgtctgtggtcatcggtcacctcttgacctcaaccccctccttcttccccttcccctaacataaaaagaagcctgaaattcatgctaacttaagatggttctttaggacactagtccgccatcttctcggtttgctggctctccgaataaagtcgccttccttgccccaacaccttgtctctcgacttattggctgtcgtgcggcgagcggtacgagctttggactcggctaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF766 19 43.0 Highly correlated
2 ZNF175 16 94.0 Weakly correlated
3 ZNF589 11 28.9 Moderately correlated
4 ZNF584 11 99.0 Weakly correlated
5 ZNF197 9 99.0 Weakly correlated
6 ZNF680 6 28.9 Moderately correlated
7 ZKSCAN8 5 160.0 Weakly correlated
8 ZNF382 5 99.0 Weakly correlated
9 ZNF317 4 99.0 Weakly correlated
10 ZNF468 2 28.9 Moderately correlated
11 ZNF705D 2 28.9 Moderately correlated
12 ZNF701 2 28.9 Moderately correlated
13 ZNF528 2 43.0 Highly correlated
14 ZIM3 2 87.0 Weakly correlated
15 ZNF274 2 99.0 Weakly correlated
16 ZNF263 2 180.0 Weakly correlated
17 ZNF490 1 43.0 Highly correlated
18 ZNF534 1 19.6 Weakly correlated
19 ZNF324 1 99.0 Weakly correlated
20 ZNF28 1 28.9 Moderately correlated
21 ZNF679 1 28.9 Moderately correlated
22 ZNF284 1 43.0 Highly correlated
23 ZNF211 1 94.0 Weakly correlated
24 ZNF799 1 43.0 Highly correlated
25 ZNF823 1 43.0 Highly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF197 4 99.0 Weakly correlated
2 ZNF175 3 94.0 Weakly correlated
3 ZNF589 2 28.9 Moderately correlated
4 ZNF584 2 99.0 Weakly correlated
5 ZIM3 1 87.0 Weakly correlated
6 ZNF284 1 43.0 Highly correlated
7 ZNF468 1 28.9 Moderately correlated
8 ZNF263 1 180.0 Weakly correlated
9 ZNF680 1 28.9 Moderately correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats