ZRdb KZFP & Repeats
...

LTR_MER83B

  • Name
    MER83B
  • Repbase
    MER83B
  • Type
    LTR
  • Emergence
    43.0 Mya
  • Dfam Id
    DF0000939
Description :

MER83B has 5bp TSDs, and is a subfamily of LTRs that associate withMER83-int to form the MER83 retrovirus.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtggagtcctgataagtaagcaacaacgaggaaggggccccaggtnggggagggccccaggtggggaagaacaatgaacaattgttctgagagacggctaatcacaaacaacccgcgggcacaacgacctcgttccgcacgtagccccagcannacgacctcgttccgcacgtagccccctccagcacgaccctataaaacttccctccagcccctgcctctttgcagacagccccttctctgctgtgctgcccgttgcaaccttgcaacgtattttcatactttctctaataaatctgcctttctttacctacaactgtcttggtaaattcctttaccgcccgcgacaccggccccagntagtcgcacccgcgaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF808 8 19.6 Weakly correlated
2 ZNF257 8 0.0 Weakly correlated
3 ZNF766 4 43.0 Highly correlated
4 ZNF585B 4 99.0 Weakly correlated
5 ZNF680 3 28.9 Moderately correlated
6 ZNF175 3 94.0 Weakly correlated
7 ZNF534 3 19.6 Weakly correlated
8 ZNF197 2 99.0 Weakly correlated
9 ZNF263 2 180.0 Weakly correlated
10 ZNF28 2 28.9 Moderately correlated
11 ZNF723 2 15.2 Weakly correlated
12 ZKSCAN8 2 160.0 Weakly correlated
13 ZNF679 1 28.9 Moderately correlated
14 ZNF486 1 8.6 Weakly correlated
15 ZNF701 1 28.9 Moderately correlated
16 ZNF705B 1 28.9 Moderately correlated
17 ZNF823 1 43.0 Highly correlated
18 ZNF92 1 28.9 Moderately correlated
19 ZNF597 1 94.0 Weakly correlated
20 ZNF589 1 28.9 Moderately correlated
21 ZNF479 1 6.4 Weakly correlated
22 ZNF468 1 28.9 Moderately correlated
23 ZNF317 1 99.0 Weakly correlated
24 ZNF222 1 43.0 Highly correlated
25 ZNF202 1 160.0 Weakly correlated
26 ZNF133 1 99.0 Weakly correlated
27 ZNF101 1 43.0 Highly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF257 5 0.0 Weakly correlated
2 ZNF534 2 19.6 Weakly correlated
3 ZNF101 1 43.0 Highly correlated
4 ZNF28 1 28.9 Moderately correlated
5 ZNF823 1 43.0 Highly correlated
6 ZNF808 1 19.6 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats