ZRdb KZFP & Repeats
...

LTR_MER68C

  • Name
    MER68C
  • Repbase
    MER68C
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000913
Description :

MER68C is found at orthologous sites in eutherian genomes, includingAfrotheria, but is absent from marsupials. Note that MER stands forMEdium Reiteration frequency interspersed repeat. As such, MERs as agroup are a grab bag of DNA transposons and retrotransposons.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgatttgcacctggtctcggtgagacccccgagagggctctgccgttggggctggttacgtagcaagaatatgcctacgtgaccagcaggatataagaagcgnnaccccagccgagactccattttgggctccctggttccgaggtgttccgtgcacacgtcggtggttcctgatccgagagagaaagtgcgtcctgccacggcccttacagagggaggacaattggagctcgcgcctggcctctccggaccccttgctgtgaggcagcctttggctgtgatgcatatccttactttaatgctgttgctatattgtatccttttcctgcaataaactgtagatttgtaagcattgtcattttgggtcctgtgagtcttctttagcaatcgaaccctgtttaactgccaccgttagtgca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF425 3 94.0 Moderately correlated
2 ZNF263 2 180.0 Weakly correlated
3 ZNF75D 2 94.0 Moderately correlated
4 ZIM3 1 87.0 Moderately correlated
5 ZNF382 1 99.0 Highly correlated
6 ZNF471 1 94.0 Moderately correlated
7 ZNF479 1 6.4 Weakly correlated
8 ZNF506 1 28.9 Weakly correlated
9 ZNF701 1 28.9 Weakly correlated
10 ZNF723 1 15.2 Weakly correlated
11 ZNF735 1 28.9 Weakly correlated
12 ZNF793 1 99.0 Highly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZIM3 1 87.0 Moderately correlated
2 ZNF75D 1 94.0 Moderately correlated
3 ZNF506 1 28.9 Weakly correlated
4 ZNF471 1 94.0 Moderately correlated
5 ZNF735 1 28.9 Weakly correlated
6 ZNF479 1 6.4 Weakly correlated
7 ZNF793 1 99.0 Highly correlated
8 ZNF263 1 180.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats