ZRdb KZFP & Repeats
...

LTR_MER34C

  • Name
    MER34C
  • Repbase
    MER34C
  • Type
    LTR
  • Emergence
    87.0 Mya
  • Dfam Id
    DF0000753
Description :

74% similar to MER34B over the entire length. Distantly related toMER39, LTR48, LTR49, LTR29 and MER4D. Possibly also in rodents. Notethat MER stands for MEdium Reiteration frequency interspersed repeat. Assuch, MERs as a group are a grab bag of DNA transposons andretrotransposons.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtaggagaccagaatatgccaccccaaaatatgcctctttggcataaggattattttgagctgattattttgagaaacngcagacacaggagaagctctgaaaacagagtanaagttacccttttgtaagggaaatttacatctataaaggaaatctccatttgtaagggtgtctccctctctgcaccaggaagagaaggatgactctaaatcactagagactcttatcaatggagaaggcaccgacttaaatctgcataacaaaccttacccttgtttaccgtgcttttcctggccacctccccataactggccttccccacacccttctttctttgtttcagcggaagatggtnatttaagcctgaantctaagccacctctttgagatttactcatttctctgggtatctcccatgtatacatgaggtatacatgttattaaacttctgtttgtttttctcttgttaatctgtcttttgttacaggggtctgtcccagctaagaactatgaagggtagagagaaaattatttttttcctcccctaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF589 3 28.9 Weakly correlated
2 ZNF175 2 94.0 Weakly correlated
3 ZNF382 2 99.0 Weakly correlated
4 ZNF479 2 6.4 Weakly correlated
5 ZNF766 2 43.0 Weakly correlated
6 ZFP37 1 99.0 Weakly correlated
7 ZIM3 1 87.0 Highly correlated
8 ZKSCAN8 1 160.0 Weakly correlated
9 ZNF197 1 99.0 Weakly correlated
10 ZNF528 1 43.0 Weakly correlated
11 ZNF584 1 99.0 Weakly correlated
12 ZNF723 1 15.2 Weakly correlated
13 ZNF823 1 43.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZIM3 1 87.0 Highly correlated
2 ZNF528 1 43.0 Weakly correlated
3 ZNF479 1 6.4 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats