ZRdb KZFP & Repeats
...

LTR_MER129

  • Name
    MER129
  • Repbase
    MER129
  • Type
    LTR
  • Emergence
    319.0 Mya
  • Dfam Id
    DF0000725
Description :

MER129 is found in mammals and chicken. The reconstructed sequence maybe incomplete. Classification based on TG...CA termini, although theedges of the element are still uncertain (no TSDs recognized).Detectably similar to flanking regions of turtle CryIIB SINE (fromRepbase). Note that MER stands for MEdium Reiteration frequencyinterspersed repeat. As such, MERs as a group are a grab bag of DNAtransposons and retrotransposons.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tggaatnccattataaggatcgatttgggcgaccnccgttttgatcgttacatccgaatgatcacnacgcncagatccataaaacagtgagcttcccaaatcagacgcgtgcanagaagcaaaatctccattttgcgaggacggagcgagttctnctaggcattttagtgccacggcaggtcagtcaagttataattggctctaattagcactcccacaagctgtaacattctttacctgcagccgagtggcactcaaaaaggtgagaaattctttcctacctttgaaaacatcaaagaaaatcaaagaaatcgcttccaatctgatccttacaaccgaatgccccgctgatcagcataagcgaggggcaaacgcatcagcaccgataggaaatggcttttggaaagtaagatttgatccatanagccgaacgatcactacaagcngcgatcagcgaaaccgaattcca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 6 99.0 Weakly correlated
2 ZNF75D 4 94.0 Weakly correlated
3 ZNF2 3 99.0 Weakly correlated
4 ZFP37 2 99.0 Weakly correlated
5 ZNF263 2 180.0 Weakly correlated
6 ZNF394 2 99.0 Weakly correlated
7 ZNF766 2 43.0 Weakly correlated
8 ZNF133 1 99.0 Weakly correlated
9 ZNF248 1 99.0 Weakly correlated
10 ZNF528 1 43.0 Weakly correlated
11 ZNF534 1 19.6 Weakly correlated
12 ZNF554 1 99.0 Weakly correlated
13 ZNF558 1 99.0 Weakly correlated
14 ZNF597 1 94.0 Weakly correlated
15 ZNF679 1 28.9 Weakly correlated
16 ZNF735 1 28.9 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF75D 2 94.0 Weakly correlated
2 ZNF528 1 43.0 Weakly correlated
3 ZNF735 1 28.9 Weakly correlated
4 ZNF133 1 99.0 Weakly correlated
5 ZNF263 1 180.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats