ZRdb KZFP & Repeats
...

LTR_LTR9C

  • Name
    LTR9C
  • Repbase
    LTR9C
  • Type
    LTR
  • Emergence
    43.0 Mya
  • Dfam Id
    DF0000624
Description :

Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
taatacaggagttattaagaaattatttttaggcagctagaaagggtaaaagagttctcggtggaattttcctttaataaaaagcagcccccaaaccatttcttttctctaacagaaagcagcctgaaaagtcaggctgcaagcatagatatgcaaactagaagctttnatatgtaaatgccggcagctgtacctggaagccaggtacattcaatatggcgnttcccgccctcttttccttgtcaccacgtgtgccaggtgtcatggcagcctccaggtaaaaccacgtgtgcaggnnatcatggcgaccgccaggtagaggccgcatttgcataataaaaganctagggtgggagggccagtcttttcgcgggctatgtaaatggcacacctggtcaaaccaatcccctgggccctatgtaaatcaatcaccgcctcctcaagcctctgtacaaaaccgattgcgttccgccgcaaacccggagaccctctcttgggcgacccgctttctcagcatgaggaagctttttctctctcttcttcttttttgtctattaaactttccgctcctnaaacccactcctcgtgtgtgtccgtgtcctgaattctttctcggcgcgagacaaagaaccacgggtatntaccccagacaacggagccgtttca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF680 17 28.9 Moderately correlated
2 ZNF382 7 99.0 Weakly correlated
3 ZNF506 5 28.9 Moderately correlated
4 ZFP57 4 87.0 Weakly correlated
5 ZNF2 3 99.0 Weakly correlated
6 ZNF766 2 43.0 Highly correlated
7 ZNF845 1 28.9 Moderately correlated
8 ZNF793 1 99.0 Weakly correlated
9 ZNF778 1 74.0 Weakly correlated
10 ZNF705D 1 28.9 Moderately correlated
11 ZNF705B 1 28.9 Moderately correlated
12 ZNF679 1 28.9 Moderately correlated
13 ZNF534 1 19.6 Weakly correlated
14 ZNF479 1 6.4 Weakly correlated
15 ZNF317 1 99.0 Weakly correlated
16 ZNF157 1 99.0 Weakly correlated
17 ZNF101 1 43.0 Highly correlated
18 ZKSCAN5 1 160.0 Weakly correlated
19 ZIM3 1 87.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF680 5 28.9 Moderately correlated
2 ZIM3 1 87.0 Weakly correlated
3 ZKSCAN5 1 160.0 Weakly correlated
4 ZNF534 1 19.6 Weakly correlated
5 ZNF479 1 6.4 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats