ZRdb KZFP & Repeats
...

LTR_LTR86C

  • Name
    LTR86C
  • Repbase
    LTR86C
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000610
Description :

5 bp TSDs, with a bias for NNNNC.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgcaggataggccctatagctggtctaagggcctgttagcatgactcccagagacgtctgggtaactgacccttgttctagttccgcagcnctgagttcaggaatgtacttggaccaggctgtgttagcctggggaggctgagggtgataaatgaggactgtgttcatgcctgagtgtactgtactgtactgtgctctgcagtcatattgtatattgtataactccgagattgatgaggtgcacctggcccagatgaggtggtccccggcacatatccagactagcctacgtgcagaactgctccagccttatgtatataaggctgggcttggaggggggcagttgagcttccagaaggtctgatgtgaccctcactcactcagacgttatcatccgcaactgtgcgccccctggtgaggatcttggggtccggaagcttgcacctccgtctgtcctggagaatgttgctgatctctctgccgtgtatcctgactgcgctgacttccttctgtatcctttagataagtaaaccttgtttgatttacccaagtggtgtctgtgtctggtctttccgtcaatctgaacctactattgacatttgtcaatacagtggtcgtgca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 14 99.0 Highly correlated
2 ZNF263 7 180.0 Weakly correlated
3 ZNF766 5 43.0 Weakly correlated
4 ZFP69B 4 99.0 Highly correlated
5 ZNF680 4 28.9 Weakly correlated
6 ZKSCAN1 3 160.0 Weakly correlated
7 ZNF589 3 28.9 Weakly correlated
8 ZNF394 2 99.0 Highly correlated
9 ZNF723 2 15.2 Weakly correlated
10 ZNF479 2 6.4 Weakly correlated
11 ZFP37 2 99.0 Highly correlated
12 ZNF2 2 99.0 Highly correlated
13 ZNF197 2 99.0 Highly correlated
14 ZIM3 2 87.0 Moderately correlated
15 ZNF274 1 99.0 Highly correlated
16 ZNF273 1 28.9 Weakly correlated
17 ZNF563 1 28.9 Weakly correlated
18 ZNF584 1 99.0 Highly correlated
19 ZNF596 1 94.0 Moderately correlated
20 ZNF679 1 28.9 Weakly correlated
21 ZNF101 1 43.0 Weakly correlated
22 ZKSCAN8 1 160.0 Weakly correlated
23 ZNF845 1 28.9 Weakly correlated
24 ZNF92 1 28.9 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF263 2 180.0 Weakly correlated
2 ZIM3 1 87.0 Moderately correlated
3 ZNF723 1 15.2 Weakly correlated
4 ZNF680 1 28.9 Weakly correlated
5 ZNF479 1 6.4 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats