ZRdb KZFP & Repeats
...

LTR_LTR86B2

  • Name
    LTR86B2
  • Repbase
    LTR86B2
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000609
Description :

5 bp TSDs, with a bias for NNNNC. Orientation based on ATTAAA siteconserved in other LTR86 consensuses.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgcaggaatagacctcaggcaggcctgaagcctgggcctgctagggggatggtacgcctgggaaactgaccttcgattcacccagtctcgcagtaaacactcaggaatgtgctggggttgttaccagttacttgcacctggtgagcaggcaggcacgtagccagagtctccagaacagttgggaggggccaggagggtataaancccccgtgagaatggcaaagggagcttctcgaaggacctgacgggatcctcaccccgatcaggcggtatcatcggcagctgggcgccttcgtggggacttgaaggccagggaagcttgcccctccgactgggagtgctgctgngtcccctgctctgtgnagccgtctncgtgtagntaagttcttgtatcctttacctacattaaaggaacttgtatcctttgcctgtgtctgttggtatctttccgtcaatcacatcaccatcccnttgtgacaaccgcgca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 4 99.0 Highly correlated
2 ZNF263 4 180.0 Weakly correlated
3 ZFP57 3 87.0 Moderately correlated
4 ZNF534 3 19.6 Weakly correlated
5 ZNF175 3 94.0 Moderately correlated
6 ZFP69B 2 99.0 Highly correlated
7 ZNF584 2 99.0 Highly correlated
8 ZNF394 2 99.0 Highly correlated
9 ZKSCAN1 2 160.0 Weakly correlated
10 ZNF26 1 99.0 Highly correlated
11 ZNF257 1 0.0 Weakly correlated
12 ZNF182 1 99.0 Highly correlated
13 ZNF479 1 6.4 Weakly correlated
14 ZNF519 1 19.6 Weakly correlated
15 ZIM3 1 87.0 Moderately correlated
16 ZNF679 1 28.9 Weakly correlated
17 ZNF701 1 28.9 Weakly correlated
18 ZNF765 1 8.6 Weakly correlated
19 ZNF789 1 99.0 Highly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZFP57 1 87.0 Moderately correlated
2 ZFP69B 1 99.0 Highly correlated
3 ZIM3 1 87.0 Moderately correlated
4 ZNF263 1 180.0 Weakly correlated
5 ZNF382 1 99.0 Highly correlated
6 ZNF479 1 6.4 Weakly correlated
7 ZNF534 1 19.6 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats