ZRdb KZFP & Repeats
...

LTR_LTR86A2

  • Name
    LTR86A2
  • Repbase
    LTR86A2
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000607
Description :

5 bp TSDs, with a bias for NNNNC. Orientation based on AATAAA siteconserved in all LTR86 consensuses.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtggggagatgggctttctgggacactggaaagctggaggcagagatattgttcagggacacctgggcactgactctgctttctccccccggatgaggatgtggccttgctgatgctgagtttggttcaagaaccaggagagcccgatgtttgtaaacattcccttaaatggaagcgcacagattgttagtgtaagttcttccggaatggtgatgtaagcctgagtataaaagggcagtggcgtagcaagaattcggcttctttctcaactctggcaggaccctaccttgcacggagagtgtcaccggcagctgcgtgccccgttagggaaccnaggggccagggaaaagccgcgcnaagatatgctgcatctgctcctgctctgtgtagccacctcgcttccgttaagttctgtatccttggctaaataaatcgggaacttatagcaggtgtgtgtgtgtgtgttggtctcttcccgccaatccgtaacccacctgaaacgctaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 19 99.0 Highly correlated
2 ZNF679 4 28.9 Weakly correlated
3 ZNF394 4 99.0 Highly correlated
4 ZNF680 3 28.9 Weakly correlated
5 ZNF766 3 43.0 Weakly correlated
6 ZIM3 2 87.0 Moderately correlated
7 ZNF331 2 94.0 Moderately correlated
8 ZNF101 2 43.0 Weakly correlated
9 ZKSCAN8 2 160.0 Weakly correlated
10 ZKSCAN1 2 160.0 Weakly correlated
11 ZNF789 1 99.0 Highly correlated
12 ZNF786 1 99.0 Highly correlated
13 ZNF778 1 74.0 Weakly correlated
14 ZNF793 1 99.0 Highly correlated
15 ZNF723 1 15.2 Weakly correlated
16 ZNF705D 1 28.9 Weakly correlated
17 ZFP37 1 99.0 Highly correlated
18 ZNF701 1 28.9 Weakly correlated
19 ZNF8 1 99.0 Highly correlated
20 ZNF641 1 99.0 Highly correlated
21 ZNF597 1 94.0 Moderately correlated
22 ZNF554 1 99.0 Highly correlated
23 ZNF528 1 43.0 Weakly correlated
24 ZNF506 1 28.9 Weakly correlated
25 ZNF485 1 94.0 Moderately correlated
26 ZNF429 1 28.9 Weakly correlated
27 ZNF324 1 99.0 Highly correlated
28 ZNF317 1 99.0 Highly correlated
29 ZNF2 1 99.0 Highly correlated
30 ZNF264 1 99.0 Highly correlated
31 ZNF263 1 180.0 Weakly correlated
32 ZNF257 1 0.0 Weakly correlated
33 ZNF18 1 160.0 Weakly correlated
34 ZNF175 1 94.0 Moderately correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF263 2 180.0 Weakly correlated
2 ZNF382 2 99.0 Highly correlated
3 ZIM3 1 87.0 Moderately correlated
4 ZKSCAN1 1 160.0 Weakly correlated
5 ZNF680 1 28.9 Weakly correlated
6 ZNF506 1 28.9 Weakly correlated
7 ZNF723 1 15.2 Weakly correlated
8 ZNF793 1 99.0 Highly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats