ZRdb KZFP & Repeats
...

LTR_LTR84A

  • Name
    LTR84A
  • Repbase
    LTR84a
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000601
Description :

Classification only on 5 bp TSDs. Orientation based on AATAAA at pos618-623 which is conserved in the similar LTR83.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgttatgggagatcctcgggaaaatccccaaatggggcctgagacccctggcactgccatgtaatgatttttccttctcatgggaacagatgggactaatagattatgaccattgttcttaagcaaggtatgccaaggtcgctgtgccctttcctgaaagataggctgcatatctgcactgagggagaatgaataacatctgcaaatcccctgcttaaagcccctttgtttagaaatcctgcttgcttgcctttttgatatgtatgtctccataaatagattagggagaaacttgtccctttgtatcccaaataaggcaaaaggaagttgtaattggatttcaccatgggcccacaatttctgccccggggaaagtaataaaaagggtcagaacaccccctccctttgctggaacggtcgcctggtattccctgcagaggctcggctgtaggctgtaggcaaaacccctctgtcgtctgcccccaatcactgagtgagcaacgccagctctggggcccaggaccgttcggacgattgaagattcccaccttcaggcagagggctggaagcagtgcgggtaatatctagatattgtttgggcattgcatttgatagggaataaagggcatgtgaaaccctttgaccggtctctgtctcttggtgtcctgaaatttccgtctcattgcgattaaaagaatcaaagtacggtctggcccagagaggggaggcatccccaagtttggcagaccctaaaaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 14 99.0 Highly correlated
2 ZFP37 7 99.0 Highly correlated
3 ZNF394 6 99.0 Highly correlated
4 ZNF263 6 180.0 Weakly correlated
5 ZIM3 5 87.0 Moderately correlated
6 ZNF680 5 28.9 Weakly correlated
7 ZNF705B 4 28.9 Weakly correlated
8 ZNF701 4 28.9 Weakly correlated
9 ZNF705D 4 28.9 Weakly correlated
10 ZNF251 3 94.0 Moderately correlated
11 ZNF584 3 99.0 Highly correlated
12 ZKSCAN1 3 160.0 Weakly correlated
13 ZNF679 3 28.9 Weakly correlated
14 ZNF320 3 28.9 Weakly correlated
15 ZNF2 3 99.0 Highly correlated
16 ZNF766 3 43.0 Weakly correlated
17 ZNF175 3 94.0 Moderately correlated
18 ZNF28 2 28.9 Weakly correlated
19 ZNF793 2 99.0 Highly correlated
20 ZNF75D 2 94.0 Moderately correlated
21 ZNF534 2 19.6 Weakly correlated
22 ZNF723 2 15.2 Weakly correlated
23 ZNF585A 2 99.0 Highly correlated
24 ZNF786 1 99.0 Highly correlated
25 ZNF8 1 99.0 Highly correlated
26 ZNF597 1 94.0 Moderately correlated
27 ZNF589 1 28.9 Weakly correlated
28 ZNF554 1 99.0 Highly correlated
29 ZNF479 1 6.4 Weakly correlated
30 ZNF354C 1 99.0 Highly correlated
31 ZNF274 1 99.0 Highly correlated
32 ZNF26 1 99.0 Highly correlated
33 ZNF264 1 99.0 Highly correlated
34 ZNF257 1 0.0 Weakly correlated
35 ZNF248 1 99.0 Highly correlated
36 ZNF197 1 99.0 Highly correlated
37 ZNF140 1 99.0 Highly correlated
38 ZNF136 1 74.0 Weakly correlated
39 ZNF133 1 99.0 Highly correlated
40 ZFP69B 1 99.0 Highly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF705B 3 28.9 Weakly correlated
2 ZNF263 2 180.0 Weakly correlated
3 ZNF705D 2 28.9 Weakly correlated
4 ZNF133 1 99.0 Highly correlated
5 ZNF140 1 99.0 Highly correlated
6 ZNF2 1 99.0 Highly correlated
7 ZNF382 1 99.0 Highly correlated
8 ZNF534 1 19.6 Weakly correlated
9 ZNF679 1 28.9 Weakly correlated
10 ZNF793 1 99.0 Highly correlated
11 ZNF723 1 15.2 Weakly correlated
12 ZNF320 1 28.9 Weakly correlated
13 ZNF585A 1 99.0 Highly correlated
14 ZNF354C 1 99.0 Highly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats