ZRdb KZFP & Repeats
...

LTR_LTR81AB

  • Name
    LTR81AB
  • Repbase
    LTR81AB
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000595
Description :

Shared with afrotheria; absent from marsupials.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtaacggggataatattttgcaaatattaaaccgatgcattttcatttccctcttaaatcatgttcccttgcagccttctacctccaaggctgagccatgaggcttattgccccagggaagtactgcctagaacaaagaggccattgntcagctttgagtctcaaagctgactttcttganctctttagcaagacaatagtcttgaaagccaggctttgtngagagagaaaaggattttctaaattcctttagctccctttaacatatcaagagcca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 4 99.0 Highly correlated
2 ZNF394 4 99.0 Highly correlated
3 ZNF793 2 99.0 Highly correlated
4 ZNF705B 2 28.9 Weakly correlated
5 ZNF425 1 94.0 Moderately correlated
6 ZNF91 1 6.0 Weakly correlated
7 ZNF766 1 43.0 Weakly correlated
8 ZNF705D 1 28.9 Weakly correlated
9 ZNF701 1 28.9 Weakly correlated
10 ZNF597 1 94.0 Moderately correlated
11 ZNF549 1 87.0 Moderately correlated
12 ZNF429 1 28.9 Weakly correlated
13 ZFP37 1 99.0 Highly correlated
14 ZNF263 1 180.0 Weakly correlated
15 ZNF197 1 99.0 Highly correlated
16 ZNF133 1 99.0 Highly correlated
17 ZNF101 1 43.0 Weakly correlated
18 ZKSCAN1 1 160.0 Weakly correlated
19 ZIM3 1 87.0 Moderately correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZIM3 1 87.0 Moderately correlated
2 ZNF101 1 43.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats