ZRdb KZFP & Repeats
...

LTR_LTR81

  • Name
    LTR81
  • Repbase
    MamGypLTR2
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000593
Description :

4 bp TSDs. Not clear if the 5' end has been identified. 3' end muchbetter represented. Intermediate between 2a and 2b/c noted. Renamedfrom MamGypLTR2 to LTR81, despite the less telling name, since theearlier characterized LTR81A-C elements are different subfamilies ofthis element (and the elements MamGypLTR2b & c are more distantlyrelated).
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtaacatggataatatttttgaaaatacttcccaattatgttcccttattggtaagccggtttctctctccctgcaccatccgccattatggccccagggaaggggcaaggcngatgccaccctaggaagaaggaggatatgacgtaggggaagtccntgccaganaggaagaggaagtggaaagcccgccccttccagccccggnggattgtgggaagaagagagaggcggaagtagagcaaggaggtcagatgccagggtcctcgcttcctcccctccctgggcccgaacccaggatgggggggggngctttagaaacatccagataggtatgggggagcccgagaacatcggggctagtggcccgcttccccgggcatagccgggggaggctgcaggcctctaggagaagccccgcgtttggctcggcgccacgtccaacgtggcgcgggagcgacggcgcagcgntggcggagggaggtgnctagatagatgagcctgaggcagcgctcctggctccccacggcctgcgtgtggcatgcaggggatccagaagttcccgcgtgccccggtgaggggacgcggaggtgctgagagggccggtggaccagcagaggcctggggtcaggacaaagaggccgcngtgngcggggacttcgngaccggaggcaaatggccgggaccacggactccagcggtgggtgccagcacatcaccccaaaaggccagatgggaccagtcgcacctcagcggtcaccagtccagggagcagaccagaccagccactccgcagcagagaccagcgaggatccagaggacnccgcatggatccgaggnccccctctcccctnccgccacgaggtcacatgagcccacactcccccatacacccagatgccatcttggagaggagcagggggaggaggaggaaatctgaaagactgagcatttacccgaaagagactgagtcatccaaaagagactaatttacctaaaagagactgtttaaattattggaccggactaagtttaccagactggactaaaatttagtcgttctcncgcccctcgctacccagcggggtgggggctcgtgaggaagatcagatcagttatagagaaataaagaagctacattttctttgcacatctgagtgtagtgtgagtaaatttgcgaccccgctaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 17 99.0 Highly correlated
2 ZNF263 7 180.0 Weakly correlated
3 ZNF766 6 43.0 Weakly correlated
4 ZFP37 5 99.0 Highly correlated
5 ZNF589 4 28.9 Weakly correlated
6 ZNF680 4 28.9 Weakly correlated
7 ZNF479 4 6.4 Weakly correlated
8 ZNF394 4 99.0 Highly correlated
9 ZNF2 4 99.0 Highly correlated
10 ZNF610 3 28.9 Weakly correlated
11 ZNF558 3 99.0 Highly correlated
12 ZNF554 3 99.0 Highly correlated
13 ZNF324 3 99.0 Highly correlated
14 ZNF175 3 94.0 Moderately correlated
15 ZNF101 3 43.0 Weakly correlated
16 ZNF317 3 99.0 Highly correlated
17 ZNF506 2 28.9 Weakly correlated
18 ZFP69B 2 99.0 Highly correlated
19 ZNF584 2 99.0 Highly correlated
20 ZIM3 2 87.0 Moderately correlated
21 ZKSCAN1 2 160.0 Weakly correlated
22 ZNF534 2 19.6 Weakly correlated
23 ZNF528 2 43.0 Weakly correlated
24 ZKSCAN8 2 160.0 Weakly correlated
25 ZNF792 2 94.0 Moderately correlated
26 ZNF701 1 28.9 Weakly correlated
27 ZNF679 1 28.9 Weakly correlated
28 ZNF705B 1 28.9 Weakly correlated
29 ZFP28 1 99.0 Highly correlated
30 ZNF705D 1 28.9 Weakly correlated
31 ZNF707 1 74.0 Weakly correlated
32 ZNF677 1 99.0 Highly correlated
33 ZNF8 1 99.0 Highly correlated
34 ZNF658 1 99.0 Highly correlated
35 ZNF597 1 94.0 Moderately correlated
36 ZNF530 1 28.9 Weakly correlated
37 ZNF485 1 94.0 Moderately correlated
38 ZNF471 1 94.0 Moderately correlated
39 ZNF468 1 28.9 Weakly correlated
40 ZNF343 1 74.0 Weakly correlated
41 ZNF33A 1 99.0 Highly correlated
42 ZNF251 1 94.0 Moderately correlated
43 ZNF140 1 99.0 Highly correlated
44 ZNF133 1 99.0 Highly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF479 3 6.4 Weakly correlated
2 ZIM3 2 87.0 Moderately correlated
3 ZNF382 2 99.0 Highly correlated
4 ZNF263 2 180.0 Weakly correlated
5 ZFP28 1 99.0 Highly correlated
6 ZFP37 1 99.0 Highly correlated
7 ZNF317 1 99.0 Highly correlated
8 ZNF468 1 28.9 Weakly correlated
9 ZNF554 1 99.0 Highly correlated
10 ZNF471 1 94.0 Moderately correlated
11 ZNF534 1 19.6 Weakly correlated
12 ZNF792 1 94.0 Moderately correlated
13 ZNF506 1 28.9 Weakly correlated
14 ZNF680 1 28.9 Weakly correlated
15 ZNF485 1 94.0 Moderately correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats