ZRdb KZFP & Repeats
...

LTR_LTR80B

  • Name
    LTR80B
  • Repbase
    LTR80B
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000592
Description :

5 bp TSDs. Orientation unknown.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgggaaggaaanggttaagcagcaggtctgcaatccattctctccctttactgggaggacgcccctgggaaagaaagaaggaaggtgacccggtcaaatctccttgtaaacatgctaatgacagacctcctggcaaacanactaatggtatttgctagcgggagagtccttatctatggaatgcttttagcaggatgtacctggtctgtctaggattgcttatggtaaacaaacctggaatctatggatttatggggcatggctccctggaaaatgtcacgtaagctatgtaactatctgagtataaaatggagatgtttcatgaccgaaacggctcccttctgtgtaagtgatgtagccgcatacatcacttagagacctcatatgttaatctgggccagagcgcatcctgatgcggcaagaaaggacctggggagctgcgttggcggtcccggacctctccctgcttcgcctgtgcctcgcgattacttgtatccttgaaattattagtaaagcttgatactgggtaagatctctgattcntgtgagtctgatttgacaatccgatcctttgtgttatctca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 11 99.0 Highly correlated
2 ZIM3 3 87.0 Moderately correlated
3 ZNF679 3 28.9 Weakly correlated
4 ZNF263 3 180.0 Weakly correlated
5 ZNF394 3 99.0 Highly correlated
6 ZNF534 2 19.6 Weakly correlated
7 ZNF766 2 43.0 Weakly correlated
8 ZNF701 2 28.9 Weakly correlated
9 ZNF610 2 28.9 Weakly correlated
10 ZNF479 2 6.4 Weakly correlated
11 ZNF2 2 99.0 Highly correlated
12 ZNF257 2 0.0 Weakly correlated
13 ZNF18 2 160.0 Weakly correlated
14 ZNF93 1 8.6 Weakly correlated
15 ZNF317 1 99.0 Highly correlated
16 ZNF778 1 74.0 Weakly correlated
17 ZNF175 1 94.0 Moderately correlated
18 ZNF723 1 15.2 Weakly correlated
19 ZNF705D 1 28.9 Weakly correlated
20 ZNF705B 1 28.9 Weakly correlated
21 ZNF680 1 28.9 Weakly correlated
22 ZNF197 1 99.0 Highly correlated
23 ZNF589 1 28.9 Weakly correlated
24 ZNF554 1 99.0 Highly correlated
25 ZNF547 1 74.0 Weakly correlated
26 ZIK1 1 87.0 Moderately correlated
27 ZNF528 1 43.0 Weakly correlated
28 ZNF506 1 28.9 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF534 2 19.6 Weakly correlated
2 ZIM3 1 87.0 Moderately correlated
3 ZNF197 1 99.0 Highly correlated
4 ZNF317 1 99.0 Highly correlated
5 ZNF175 1 94.0 Moderately correlated
6 ZNF701 1 28.9 Weakly correlated
7 ZNF93 1 8.6 Weakly correlated
8 ZNF589 1 28.9 Weakly correlated
9 ZNF766 1 43.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats