ZRdb KZFP & Repeats
...

LTR_LTR80A

  • Name
    LTR80A
  • Repbase
    LTR80A
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000591
Description :

5 bp TSDs. Orientation unknown.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tggggaggaaggagttaaagcagctggcctgtgatccatttctctcctnttaccggggggacgctcctgggaaagaaagaaggcaggtgacccggtctaatctccttgtaaacatgctgataactggacctccnggtaaatagactaatgatatttgctaggaggagagtccttatctatggaatgctcttagcaggatgtccctggttnaggattgcttatggtaaacaaacctagaatctatggatttatgaggcatggctccctggagaatgtcacgtaagctatacaactntctggggtataaaatggagatgtttcataacctaaacgctccctgctgtgtgaggtaacccgcaaacctcacttagagacctcatctattattctgggccagagagcgcatgtccgatgcgggaaggaaggacctggggagccacncnngatgtcccagacctctccctgcttcgcctgngcctcttgattgcttgtatccttgaaattattagtaaagcttgatactgggtaagatctctgattcgtgtgagtctgatttgacaatccgatcctttgtgttagctca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF679 7 28.9 Weakly correlated
2 ZNF382 7 99.0 Highly correlated
3 ZNF479 5 6.4 Weakly correlated
4 ZNF75D 4 94.0 Moderately correlated
5 ZNF263 3 180.0 Weakly correlated
6 ZIM3 2 87.0 Moderately correlated
7 ZNF701 2 28.9 Weakly correlated
8 ZNF394 2 99.0 Highly correlated
9 ZNF766 2 43.0 Weakly correlated
10 ZNF160 2 74.0 Weakly correlated
11 ZNF705D 1 28.9 Weakly correlated
12 ZNF778 1 74.0 Weakly correlated
13 ZNF705B 1 28.9 Weakly correlated
14 ZNF786 1 99.0 Highly correlated
15 ZFP37 1 99.0 Highly correlated
16 ZNF793 1 99.0 Highly correlated
17 ZNF616 1 43.0 Weakly correlated
18 ZNF554 1 99.0 Highly correlated
19 ZNF534 1 19.6 Weakly correlated
20 ZNF43 1 43.0 Weakly correlated
21 ZNF429 1 28.9 Weakly correlated
22 ZNF317 1 99.0 Highly correlated
23 ZNF257 1 0.0 Weakly correlated
24 ZNF251 1 94.0 Moderately correlated
25 ZNF136 1 74.0 Weakly correlated
26 ZNF101 1 43.0 Weakly correlated
27 ZKSCAN1 1 160.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF479 4 6.4 Weakly correlated
2 ZNF679 2 28.9 Weakly correlated
3 ZNF701 2 28.9 Weakly correlated
4 ZKSCAN1 1 160.0 Weakly correlated
5 ZNF263 1 180.0 Weakly correlated
6 ZNF317 1 99.0 Highly correlated
7 ZNF554 1 99.0 Highly correlated
8 ZNF534 1 19.6 Weakly correlated
9 ZNF793 1 99.0 Highly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats