ZRdb KZFP & Repeats
...

LTR_LTR7Y

  • Name
    LTR7Y
  • Repbase
    No find
  • Type
    LTR
  • Emergence
    8.6 Mya
  • Dfam Id
    DF0000589
Description :

LTR of an HERVH element active 7-18 MYA, mostly in the common ancestorof gorilla, human and chimp. Updated from 2005 entry. Two copies are inthe human hg38 genome are precisely absent from the chimpanzee genome: asolo LTR at chr11:49842787-49843262 with surprisingly many mutations,and a copy with a partial internal sequence at chr9:86586832-86589058.A 21-bp sequence starting at pos 174 is present in 1 or 2 tandem copies.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtcaggcctctgagcccaggccaggccatcgcatcccctgtgacttgcacgtatacatccagatggcctgaagtaactgaagatccacaaaagaagtaaaaacagccttaactgatgacattccaccattgtgatttgttcctgccccaccctaactgatcaatgtactttgtaatctcccccacccttgctttgtagtctcccccacccttaagaaggttctttgtaattctccccacccttgagaatgtactttgtgagatccacccctgcccaccagagaacaaccccctttgactgtaattttccattaccttcccaaatcctataaaacggccccacccctatctcccttcgctgactctcttttcggactcagcccgcctgcacccaggtgaaataaacagccatgttgctcacacaaagcctgtttggtggtctcttcacacggacgcgcatgaaa
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF808 31 19.6 Weakly correlated
2 ZNF317 5 99.0 Weakly correlated
3 ZNF735 4 28.9 Weakly correlated
4 ZNF486 3 8.6 Highly correlated
5 ZNF705D 3 28.9 Weakly correlated
6 ZNF528 2 43.0 Weakly correlated
7 ZNF700 2 28.9 Weakly correlated
8 ZNF75D 2 94.0 Weakly correlated
9 ZNF160 1 74.0 Weakly correlated
10 ZNF251 1 94.0 Weakly correlated
11 ZNF324 1 99.0 Weakly correlated
12 ZNF382 1 99.0 Weakly correlated
13 ZNF506 1 28.9 Weakly correlated
14 ZNF554 1 99.0 Weakly correlated
15 ZNF701 1 28.9 Weakly correlated
16 ZNF766 1 43.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF735 4 28.9 Weakly correlated
2 ZNF701 1 28.9 Weakly correlated
3 ZNF554 1 99.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats