ZRdb KZFP & Repeats
...

LTR_LTR75_1

  • Name
    LTR75_1
  • Repbase
    LTR75_1
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000579
Description :

Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgttaccagggcagccctgatgaaataactgggaaagttcatttttcttactgtttttctttagtccctttatctataggcacagctgcttaaagaaaccagatggcccggtggcgccagagcttcntgacccctgaccagataccagagggagataagacccgcncgaaaccggcgcaaaccggaacaggcgacccctagttgcctttagatcattaacatatcattataatgctaaaattcccncccctaaaagaaaatctccgccattttgtgtacatgcgntgtatgaagacgcatgtttatgaattgcgcctgcgcgtctggagtcccaccctgcacatgctnacatncctctcccgccccgcacctagctccttaaaanccccatgcctcccattgctcggggagaaggtgcctttagagcgagagctcnctccttctccattcctggccagtgaataaaacctgnttgccttttccaattggatgttctttctttgcgaccgatacaaagtagggaaagaactcagtttaccggtgaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF766 19 43.0 Weakly correlated
2 ZNF589 17 28.9 Weakly correlated
3 ZNF175 14 94.0 Moderately correlated
4 ZNF197 12 99.0 Highly correlated
5 ZKSCAN8 8 160.0 Weakly correlated
6 ZNF584 8 99.0 Highly correlated
7 ZFP37 5 99.0 Highly correlated
8 ZKSCAN1 5 160.0 Weakly correlated
9 ZNF680 5 28.9 Weakly correlated
10 ZNF723 4 15.2 Weakly correlated
11 ZNF382 4 99.0 Highly correlated
12 ZNF394 2 99.0 Highly correlated
13 ZNF324 2 99.0 Highly correlated
14 ZNF274 2 99.0 Highly correlated
15 ZIM3 2 87.0 Moderately correlated
16 ZNF2 1 99.0 Highly correlated
17 RBAK 1 99.0 Highly correlated
18 ZNF479 1 6.4 Weakly correlated
19 ZNF506 1 28.9 Weakly correlated
20 ZNF547 1 74.0 Weakly correlated
21 ZNF549 1 87.0 Moderately correlated
22 ZNF585B 1 99.0 Highly correlated
23 ZNF263 1 180.0 Weakly correlated
24 ZNF610 1 28.9 Weakly correlated
25 ZNF248 1 99.0 Highly correlated
26 ZNF101 1 43.0 Weakly correlated
27 ZNF793 1 99.0 Highly correlated
28 ZNF92 1 28.9 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF589 7 28.9 Weakly correlated
2 ZNF197 6 99.0 Highly correlated
3 ZNF175 6 94.0 Moderately correlated
4 ZNF584 4 99.0 Highly correlated
5 ZNF723 3 15.2 Weakly correlated
6 ZNF549 1 87.0 Moderately correlated
7 ZNF248 1 99.0 Highly correlated
8 ZNF263 1 180.0 Weakly correlated
9 ZNF766 1 43.0 Weakly correlated
10 ZNF2 1 99.0 Highly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats
1 ZNF175 94.0 Moderately correlated
2 ZNF197 99.0 Highly correlated
3 ZNF589 28.9 Weakly correlated