ZRdb KZFP & Repeats
...

LTR_LTR73

  • Name
    LTR73
  • Repbase
    LTR73
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000577
Description :

Distantly related to MER41(A,B,E,F,G), MER66(A-C) and LTR58.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
ttgttacccggtgtaatgcctaccgcgtgacatagctgaatttctaccccgccctaactctgcttatctttaagaaacaggacgcctgcgataaaaagttccctttgtaaccagaccagctgagactggttagaaccaagatagccgaccaaatgacttcaaaaagacctcaggcttcattataatctcatttccatgctaaatgacactcccaccagcgccatgacagttgacaatcgccatgacaatgaccggaagaagccataaaaggacaaaaaggaaggcggcactccggttccgagaagttcnccgcccatttccggaaaagacatgaatattcctcccctcgcttttaatgcccaaccccttcattagagaaaccctatattttaaccccctcacccctcactagtcgagaagttgatttgtgagccacgctcccgcttctcaattccatggccatcgaataaagcctgcactgcttgacgctcactttcggtttcgtgtattggcttcgcgacaccgaacagggaaagaccccatcttttgggggaccggctttgtcggtaaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF766 41 43.0 Weakly correlated
2 ZNF197 33 99.0 Highly correlated
3 ZNF589 33 28.9 Weakly correlated
4 ZNF175 32 94.0 Moderately correlated
5 ZKSCAN8 30 160.0 Weakly correlated
6 ZNF584 22 99.0 Highly correlated
7 ZKSCAN1 17 160.0 Weakly correlated
8 ZNF382 7 99.0 Highly correlated
9 ZNF2 6 99.0 Highly correlated
10 ZNF534 4 19.6 Weakly correlated
11 ZNF394 4 99.0 Highly correlated
12 ZNF274 3 99.0 Highly correlated
13 ZNF597 3 94.0 Moderately correlated
14 ZNF18 3 160.0 Weakly correlated
15 ZNF679 3 28.9 Weakly correlated
16 ZNF816 2 28.9 Weakly correlated
17 ZIM3 2 87.0 Moderately correlated
18 ZNF350 2 99.0 Highly correlated
19 ZNF101 2 43.0 Weakly correlated
20 ZNF585B 1 99.0 Highly correlated
21 ZNF334 1 99.0 Highly correlated
22 ZNF263 1 180.0 Weakly correlated
23 ZNF141 1 43.0 Weakly correlated
24 ZNF701 1 28.9 Weakly correlated
25 ZNF793 1 99.0 Highly correlated
26 ZFP69B 1 99.0 Highly correlated
27 ZNF84 1 99.0 Highly correlated
28 ZNF91 1 6.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF175 12 94.0 Moderately correlated
2 ZNF197 12 99.0 Highly correlated
3 ZNF589 11 28.9 Weakly correlated
4 ZNF584 7 99.0 Highly correlated
5 ZNF766 6 43.0 Weakly correlated
6 ZNF2 2 99.0 Highly correlated
7 ZNF534 2 19.6 Weakly correlated
8 ZIM3 1 87.0 Moderately correlated
9 ZNF597 1 94.0 Moderately correlated
10 ZNF18 1 160.0 Weakly correlated
11 ZNF350 1 99.0 Highly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats
1 ZNF175 94.0 Moderately correlated
2 ZNF197 99.0 Highly correlated
3 ZNF584 99.0 Highly correlated
4 ZNF589 28.9 Weakly correlated