ZRdb KZFP & Repeats
...

LTR_LTR70

  • Name
    LTR70
  • Repbase
    LTR70
  • Type
    LTR
  • Emergence
    74.0 Mya
  • Dfam Id
    DF0000572
Description :

LTR70 appears to be a mosaic including LTR56, MER67C and LTR23.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtagnagagtgagagcctaccttcagcaggcacctggcttcaagttgcaaaactacctcctgtcatgaagatgtgaaaagtttattttgtcattgaatataaccaattagcatacacggatggcctccccaattaccaggtgaatttaggatgaactatgtatgacatggtgctgtaaattcttctacttgtggactaattatggtgaccgtctttctgtctttgcaatctcttaagcagattgactgtgatgcatgtcacattcnggtttaattgtgtaataaaacagttttctttctgttctattattgtggagtttctctggggctggaganaatttttcttttaattatattttccaaacactgtccagaattaccagacatgatataaacacataaggtgccaaccaggctttactctagaggggactttccctctcaggcttccagtcaactcacagttgtgcngcaaagtgcacgctgtcccctaaatatgcaggcagaattgtgtctctgcctatttggtatctatagtcctctacagtcacttctagagaggctagaccagatttctacaaacttcacagggcagcaatcagccatttcacctctttcagtgactcttgtatcttcagacctgaaactgattcagagaccatggggcccagaaacccaatcagagtaacacgtgtgcattgagtagacatgtagacatgagaatctccactttccccttcctcctcttgccaaaatgcccacaaatgtgcaggtaacacctgccgctactccanccatccaggacctaaatctgcagctccaaattctgaatctaggtcttgagatttgggaaataaaaaanaacttttatctgaggaatgcaagtccttttagttatcagactcagagagacattaaaatgagagcgcagttatgtctttctcccccctttgaactatgtattcatctcttgaaactgttcgctattgccacaagtagctataaattaaactaataatgccacactggacactatancccataccctaaaccttaacgatatatatccaatcaataatcaatgttatttctgtaaataaataagaatttctgacaaacaactttgtatcagcccactctctgtccctctctttttgcctttacaaatccacttgtaactgctgctaatcaaagtgtagattcnaggcaacttgaatctttgctcccaggttacaatcctcaagcttggcccaaataaactgtctacttatattcatgttgcgtca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF263 3 180.0 Weakly correlated
2 ZIM3 2 87.0 Weakly correlated
3 ZNF382 1 99.0 Weakly correlated
4 ZNF429 1 28.9 Weakly correlated
5 ZNF486 1 8.6 Weakly correlated
6 ZNF554 1 99.0 Weakly correlated
7 ZNF558 1 99.0 Weakly correlated
8 ZNF723 1 15.2 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF263 2 180.0 Weakly correlated
2 ZIM3 1 87.0 Weakly correlated
3 ZNF723 1 15.2 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats