ZRdb KZFP & Repeats
...

LTR_LTR6B

  • Name
    LTR6B
  • Repbase
    LTR6B
  • Type
    LTR
  • Emergence
    19.6 Mya
  • Dfam Id
    DF0000570
Description :

Present at orthologous sites in gibbon, but absent from rhesus andbaboon.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtaatgcccaaccttgtttttactaaccctgtttttagactctccctttcctttaatcacctagccttgtttccacctgaattgactctcccttagctaagagagccagacagactccatcttggctctttcactggcagccccttcctcaaggacttaacttgtgcaagctgactcccagcacatccaagaatgcaattaactgataagatactgtggcgagctatatccgcagttcccaggaattcgtccgattgataacgcccaaagccccgcgtctatcaccttgtaatagtcttaaagcccctgcacctggaactgtttactttcctgtaaccatttatccttttaacttttttgcctactttacttctgtaaaattgttttaactagaccccccctcccctttctaaaccaaagtataaaagaaaatctagccccttcttcggggccgagagaactttgagcgttagccgtctctcggccgccggctaaataaacggactcttaattcgtctcaaagtgtggcgttttctctaactcgctcgggtacaaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF766 32 43.0 Weakly correlated
2 ZNF175 29 94.0 Weakly correlated
3 ZNF589 22 28.9 Weakly correlated
4 ZNF197 21 99.0 Weakly correlated
5 ZNF584 21 99.0 Weakly correlated
6 ZKSCAN8 13 160.0 Weakly correlated
7 ZNF382 3 99.0 Weakly correlated
8 ZNF394 2 99.0 Weakly correlated
9 ZNF679 2 28.9 Weakly correlated
10 ZNF2 2 99.0 Weakly correlated
11 ZNF28 2 28.9 Weakly correlated
12 ZNF133 2 99.0 Weakly correlated
13 ZFP37 1 99.0 Weakly correlated
14 ZNF429 1 28.9 Weakly correlated
15 ZNF486 1 8.6 Moderately correlated
16 ZNF257 1 0.0 Weakly correlated
17 ZNF597 1 94.0 Weakly correlated
18 ZNF610 1 28.9 Weakly correlated
19 ZNF674 1 99.0 Weakly correlated
20 ZNF101 1 43.0 Weakly correlated
21 ZNF705D 1 28.9 Weakly correlated
22 ZNF735 1 28.9 Weakly correlated
23 ZFP57 1 87.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF175 11 94.0 Weakly correlated
2 ZNF197 10 99.0 Weakly correlated
3 ZNF589 9 28.9 Weakly correlated
4 ZNF584 9 99.0 Weakly correlated
5 ZNF674 1 99.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats
1 ZNF175 94.0 Weakly correlated
2 ZNF197 99.0 Weakly correlated
3 ZNF584 99.0 Weakly correlated
4 ZNF589 28.9 Weakly correlated