ZRdb KZFP & Repeats
...

LTR_LTR69

  • Name
    LTR69
  • Repbase
    LTR69
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000568
Description :

5 bp TSDs.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtagtatactataagagacatatcgtggctataagattaatgatagccataaggcccactcaaacatctcgcagggccgacactacgtgtcacttagcagtatgatgcaacctggcctggggatttccaaccctggcccggggatttccaggtcnntatgacgacgnnncctaaaaancctggttgcccnagagacaaggccacctcagcacagatgcaactttcataaaccttaaaacaaagcttacccttacaagaatagcttaaactccctttatgaaagaaacacctggtaactgacccggactgaatacaggtataagaaagggggaagaatcccccaaactctgagaatggtctccggacggagaccctcccggtcagncggtcatctgacccctgactgtatctggcccatgccaccggcctgctcccgctatccgtcttgtaagagcgctgccagaataaactgcttgagcatcagacggtgtctaagactcatctttgacgcgaatcggaccgaaggggaaaagtcgcccctggggaagctggttaactaggaccacccgagacccccgaacacgaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 6 99.0 Highly correlated
2 ZNF589 5 28.9 Weakly correlated
3 ZNF175 4 94.0 Moderately correlated
4 ZNF584 4 99.0 Highly correlated
5 ZNF597 4 94.0 Moderately correlated
6 ZFP37 3 99.0 Highly correlated
7 ZKSCAN1 2 160.0 Weakly correlated
8 ZKSCAN8 2 160.0 Weakly correlated
9 ZNF133 2 99.0 Highly correlated
10 ZNF766 2 43.0 Weakly correlated
11 ZNF317 2 99.0 Highly correlated
12 ZNF75D 2 94.0 Moderately correlated
13 ZNF554 1 99.0 Highly correlated
14 ZNF92 1 28.9 Weakly correlated
15 ZNF765 1 8.6 Weakly correlated
16 ZNF716 1 19.6 Weakly correlated
17 ZNF679 1 28.9 Weakly correlated
18 ZNF605 1 99.0 Highly correlated
19 ZNF471 1 94.0 Moderately correlated
20 ZNF263 1 180.0 Weakly correlated
21 ZNF17 1 69.0 Weakly correlated
22 ZFP69B 1 99.0 Highly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF597 4 94.0 Moderately correlated
2 ZNF75D 1 94.0 Moderately correlated
3 ZNF17 1 69.0 Weakly correlated
4 ZNF716 1 19.6 Weakly correlated
5 ZNF263 1 180.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats