ZRdb KZFP & Repeats
...

LTR_LTR68

  • Name
    LTR68
  • Repbase
    LTR68
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000567
Description :

Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgttgggtttttaatattcatctttattaattttatcctgaatgcgcacacgaggtgttctggatcagagacagatttcttattaattacctcacagtaaaaataagcgtgttgctctcccttgccccagtccttacccctggggcgacgcgatgagagccaggtcaantntcctacgcgagtagccggacactccataggtgaaggaaaagatgagggaaaaatatttttctctttntataaaggggaagaggcagctgtccccctcccctcctgaaagggtctcctggaaagataaggatcctgggtccttactctaaccttttggnatgtaaatanaatctctccaggagccagatagccccatgtgtctcggcttttacgacctagagatgtctccaaggtctggggcttcatcttctttgaaatgtaaatacctagggagatagcgctccagtcttcctggcaccttgggagcttaacctagggacctagtccgggctgtaaccatttggccctctcggggagataagaaagttttattatcctttcggatcagagcaattaactagacaaatggctacagatctaattctcatggtatgtgaagagtaaaatgtttctaggggaagtgaaagcaaacattctctatctttatatcgtatacatttccgtgtctcaggaggctagggctttttacaggagcactgagaaatccagggaagttttatttccccaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 12 99.0 Highly correlated
2 ZNF263 8 180.0 Weakly correlated
3 ZFP37 4 99.0 Highly correlated
4 ZNF680 4 28.9 Weakly correlated
5 ZNF679 3 28.9 Weakly correlated
6 ZNF317 3 99.0 Highly correlated
7 ZFP69B 2 99.0 Highly correlated
8 ZNF792 2 94.0 Moderately correlated
9 ZNF778 2 74.0 Weakly correlated
10 ZNF682 2 28.9 Weakly correlated
11 ZNF610 2 28.9 Weakly correlated
12 ZNF486 2 8.6 Weakly correlated
13 ZNF479 2 6.4 Weakly correlated
14 ZNF324 2 99.0 Highly correlated
15 ZNF2 2 99.0 Highly correlated
16 ZNF394 2 99.0 Highly correlated
17 ZNF18 2 160.0 Weakly correlated
18 ZNF182 2 99.0 Highly correlated
19 ZNF101 2 43.0 Weakly correlated
20 ZNF85 1 28.9 Weakly correlated
21 ZNF793 1 99.0 Highly correlated
22 ZKSCAN5 1 160.0 Weakly correlated
23 ZNF766 1 43.0 Weakly correlated
24 ZNF705D 1 28.9 Weakly correlated
25 ZNF705B 1 28.9 Weakly correlated
26 ZNF701 1 28.9 Weakly correlated
27 ZNF133 1 99.0 Highly correlated
28 ZNF274 1 99.0 Highly correlated
29 ZNF597 1 94.0 Moderately correlated
30 ZNF549 1 87.0 Moderately correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF263 3 180.0 Weakly correlated
2 ZKSCAN5 1 160.0 Weakly correlated
3 ZNF479 1 6.4 Weakly correlated
4 ZNF317 1 99.0 Highly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats