ZRdb KZFP & Repeats
...

LTR_LTR59

  • Name
    LTR59
  • Repbase
    LTR59
  • Type
    LTR
  • Emergence
    43.0 Mya
  • Dfam Id
    DF0000555
Description :

LTR34 is an LTR from the MER4-int group. 4 bp TSDs.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgagaaataaaaataaaattctaagcccccaactgactgaacggaccccctcttggccaagggaaccccagagaaaccttggaagctgagttcacggccatgacgggatgggaggtcggacacgcctcattataccccctccctcgctaaccgccattaggctttcttccctaagggctaaacagaaaccagccctttcaaaagnctccacactgataatgtcgactactagcttatcttcccaggtacagaacaaagacaagatgagattaatcattccttcacccctccctgagacgtctgcttnnnnnnnncctctattccctttttcttcaaatgttcaccttatcttatgtaaaatgtagatttactgggcactaactaaagtctcacaagtatgtaatcattcgtctcactgccgcccccttttttaaggaaaatgtataaatactaaacctcctgagaacctctttggaaaaaacagccacagatgcntctgtgactcgcgtttttcccgggcgcgccctcaagctggctcaataaacctcgatgatttgagacttatgcctcagtcactcattttggttgtcactctca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 34 99.0 Weakly correlated
2 ZNF766 7 43.0 Highly correlated
3 ZIM3 3 87.0 Weakly correlated
4 ZNF679 3 28.9 Moderately correlated
5 ZNF175 2 94.0 Weakly correlated
6 ZNF589 2 28.9 Moderately correlated
7 ZNF140 2 99.0 Weakly correlated
8 ZNF18 1 160.0 Weakly correlated
9 ZNF197 1 99.0 Weakly correlated
10 ZNF257 1 0.0 Weakly correlated
11 ZNF317 1 99.0 Weakly correlated
12 ZNF44 1 43.0 Highly correlated
13 ZNF468 1 28.9 Moderately correlated
14 ZNF700 1 28.9 Moderately correlated
15 ZNF701 1 28.9 Moderately correlated
16 ZFP69B 1 99.0 Weakly correlated
17 ZNF792 1 94.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 3 99.0 Weakly correlated
2 ZIM3 2 87.0 Weakly correlated
3 ZNF766 2 43.0 Highly correlated
4 ZNF679 2 28.9 Moderately correlated
5 ZNF468 1 28.9 Moderately correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats