ZRdb KZFP & Repeats
...

LTR_LTR58

  • Name
    LTR58
  • Repbase
    LTR58
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000554
Description :

LTR58 is an LTR from the MER4-int group MLTV and HERV17 retroviruses.Putative 4 bp TSDS.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgagacagtatagggaagagactcggtcctggcagacaagagacatggtaaccaagatcccaatgggcctcacatgtccgggcatattccctcccctaccttcttgcctcccttaacaagctgacccaagtcacgtagcagaaaggnggncctctcctaacttagctgaccaggctgaattcctaaccataaaaggaagaacctaaccgtttatctccttgagtgatgtcttccaaggttgctgaagcgggactctggcattcccgataagaacctgaccagatccagccggctgaagacaagatggactccagcgctgacctttcaccgactttttcctcattataatctcattgtaatactaaaatctccgcccagggcggggcttatccgccattttctggacatgcgacgcatgttagagcatgatgccncactgcgcaggcgcnaaaaannccccgcctaaacatgcntgcctacacgtcgctcctttttcccgcctcagcttccttaaaatgacaagagccgagcccctcggggagctagcaccgggatccctttcccgtacgctgctcccttgcgttgctcgagccgcaagcctattaaaccttgcctgagaaaatctgtttggcctggtgttaatttctacttacgcgagagccaaggaactcggggtcca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF766 6 43.0 Weakly correlated
2 ZNF175 4 94.0 Moderately correlated
3 ZNF589 4 28.9 Weakly correlated
4 ZKSCAN8 3 160.0 Weakly correlated
5 ZKSCAN1 2 160.0 Weakly correlated
6 ZNF197 2 99.0 Highly correlated
7 ZNF584 2 99.0 Highly correlated
8 ZNF18 1 160.0 Weakly correlated
9 ZNF257 1 0.0 Weakly correlated
10 ZNF705D 1 28.9 Weakly correlated
11 ZNF92 1 28.9 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF175 2 94.0 Moderately correlated
2 ZNF589 1 28.9 Weakly correlated
3 ZNF257 1 0.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats