ZRdb KZFP & Repeats
...

LTR_LTR47B4

  • Name
    LTR47B4
  • Repbase
    No find
  • Type
    LTR
  • Emergence
    74.0 Mya
  • Dfam Id
    DF0000535
Description :

At least three subgroups. All 4 described LTR47B subfamilies are absentfrom rodents and other mammals.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtggggacaagagtgactttattttaaatgctaatccgccatgtaacttctgactaaccccgagtccgggaatgcctccaaaatgtctagttgatgtattactctttatgtaggaacacctattcactgtaagtttcctccaaaacaacccttgatgctgttgcagaaatcataggctgtgacgcccgtagccacctacacattccttccagagcacgtatactttttccccaagatataagccctgggtctggggggttgcggtgcggagatctacctgtcttgcggccgcccaagaccacgcttctgtctgtaagttcccctaataaatcacccnanaccgacaaactggatttgtctgcctccttctttggtttctcggctccttcggcatttgggggtcgctttgcatatacggccctttcacggaaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 11 99.0 Weakly correlated
2 ZNF766 6 43.0 Weakly correlated
3 ZNF589 5 28.9 Weakly correlated
4 ZNF394 5 99.0 Weakly correlated
5 ZNF175 5 94.0 Weakly correlated
6 ZNF8 3 99.0 Weakly correlated
7 ZFP37 3 99.0 Weakly correlated
8 ZNF263 2 180.0 Weakly correlated
9 ZNF2 2 99.0 Weakly correlated
10 ZNF197 2 99.0 Weakly correlated
11 ZNF101 2 43.0 Weakly correlated
12 ZNF418 2 43.0 Weakly correlated
13 ZNF584 2 99.0 Weakly correlated
14 ZNF680 2 28.9 Weakly correlated
15 ZNF701 2 28.9 Weakly correlated
16 ZNF28 1 28.9 Weakly correlated
17 ZNF324 1 99.0 Weakly correlated
18 ZNF441 1 43.0 Weakly correlated
19 ZNF554 1 99.0 Weakly correlated
20 ZKSCAN8 1 160.0 Weakly correlated
21 ZNF765 1 8.6 Weakly correlated
22 ZKSCAN1 1 160.0 Weakly correlated
23 ZFP69B 1 99.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZFP37 1 99.0 Weakly correlated
2 ZNF589 1 28.9 Weakly correlated
3 ZNF263 1 180.0 Weakly correlated
4 ZNF382 1 99.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats