ZRdb KZFP & Repeats
...

LTR_LTR47B3

  • Name
    LTR47B3
  • Repbase
    No find
  • Type
    LTR
  • Emergence
    74.0 Mya
  • Dfam Id
    DF0000534
Description :

Rather similar to LTR47B2. There are more subfamilies.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtggagacaaaagtgactccatcttggatgctaatccgccatgttgacttctgattaaccccagtcccgngaatgcctcctgattcctactttatttactgtccttagtgtaagaacatgtactcactataaatcctgcctttagatcaaagcaaccttgatgttatcgcacaaattataggctatgacgcacatagcattcttgcctgttctggagggttgcctttaattgtctctatagagcacgtacaccctttccctatggtatataagccctgggtctggggagtaacggtgcggagatctacctgtcttgctgccgcccaagaccacgcttccgtccgtaagttccccaataaatcaccctttaccgacaaactggatttgtctgcctcgttctttggtttctcggctccttctgcgtttgggggtcgctttgcatatatggccctttcacggaaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 8 99.0 Weakly correlated
2 ZNF766 6 43.0 Weakly correlated
3 ZNF197 3 99.0 Weakly correlated
4 ZIM3 2 87.0 Weakly correlated
5 ZNF679 2 28.9 Weakly correlated
6 ZFP37 1 99.0 Weakly correlated
7 ZNF101 1 43.0 Weakly correlated
8 ZNF140 1 99.0 Weakly correlated
9 ZNF175 1 94.0 Weakly correlated
10 ZNF317 1 99.0 Weakly correlated
11 ZNF394 1 99.0 Weakly correlated
12 ZNF528 1 43.0 Weakly correlated
13 ZNF554 1 99.0 Weakly correlated
14 ZNF701 1 28.9 Weakly correlated
15 ZNF723 1 15.2 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF197 2 99.0 Weakly correlated
2 ZFP37 1 99.0 Weakly correlated
3 ZIM3 1 87.0 Weakly correlated
4 ZNF701 1 28.9 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats