ZRdb KZFP & Repeats
...

LTR_LTR47B2

  • Name
    LTR47B2
  • Repbase
    LTR47B2
  • Type
    LTR
  • Emergence
    74.0 Mya
  • Dfam Id
    DF0000533
Description :

Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtggagacaaaagtgactccatcttggatgctaatccgccatgttgacttctgattagccccagtcccgtgaatgcctcctgattcctactttatttactgtccctagtgtaagaacatgtcaaccttgatgttatcgcacaaattataggctatgacgcacatagcattcttgcctgttctggagggttgcctttaattgtcttgctggagcacgtataccctttccctatggtatataagccctgggtctggggagtaacagtgcggagatctacctgtcttgcggccgcccaagaccacgcttctgtctgtaagttcccccaataaancacccnntaccgacaaactggatttgtctgcctcgttctttggtttctcggctccttcggcatttgggggccgctttgcatatacggccctttcacggaaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF766 12 43.0 Weakly correlated
2 ZNF175 11 94.0 Weakly correlated
3 ZNF584 7 99.0 Weakly correlated
4 ZNF589 7 28.9 Weakly correlated
5 ZNF197 5 99.0 Weakly correlated
6 ZNF382 4 99.0 Weakly correlated
7 ZKSCAN8 3 160.0 Weakly correlated
8 ZIM3 2 87.0 Weakly correlated
9 ZNF701 2 28.9 Weakly correlated
10 ZNF263 2 180.0 Weakly correlated
11 ZNF257 2 0.0 Weakly correlated
12 ZNF705B 1 28.9 Weakly correlated
13 ZNF75D 1 94.0 Weakly correlated
14 ZNF679 1 28.9 Weakly correlated
15 ZFP69B 1 99.0 Weakly correlated
16 ZNF793 1 99.0 Weakly correlated
17 ZNF565 1 99.0 Weakly correlated
18 ZNF534 1 19.6 Weakly correlated
19 ZNF530 1 28.9 Weakly correlated
20 ZNF506 1 28.9 Weakly correlated
21 ZNF479 1 6.4 Weakly correlated
22 ZNF436 1 180.0 Weakly correlated
23 ZNF394 1 99.0 Weakly correlated
24 ZNF2 1 99.0 Weakly correlated
25 ZNF251 1 94.0 Weakly correlated
26 ZNF211 1 94.0 Weakly correlated
27 ZNF133 1 99.0 Weakly correlated
28 ZKSCAN1 1 160.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF701 2 28.9 Weakly correlated
2 ZNF479 1 6.4 Weakly correlated
3 ZNF75D 1 94.0 Weakly correlated
4 ZKSCAN8 1 160.0 Weakly correlated
5 ZNF506 1 28.9 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats