ZRdb KZFP & Repeats
...

LTR_LTR47B

  • Name
    LTR47B
  • Repbase
    LTR47B
  • Type
    LTR
  • Emergence
    74.0 Mya
  • Dfam Id
    DF0000532
Description :

Solo LTR47B elements are flanked by 5 bp TSDs. LTR47B sequences belongpresumably to the endogenous retrovirus HERV47 related to the mouseretrovirus MERVL and human retroviruses HERVL and HERV17. Pol proteinshows significant similarity to the Pol proteins encoded by MERVL andfoamy viruses.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtggaggctaaagtaactccatcttggaagctaatccgccatgttgacttctgattaaccccggttccgggaatgcctctgagatttccagtttatctattgttccttgtgtaagagcacgtacttaccgtaaatcctgcccttagatcaaatcaaccttgataaactcatacttaccgtaaatcctgcccttagacaaattcctacccattccctctgaagcacgtgtaccctttccctatggtatataatccctgggtctggggggtaatggcgcggagatctacctgtcttgcggccgcccaagaccacgcttctgtccgtaagttccccaataaaatcaccctataacgacaagctggacttgtctgcctcttctttggtttctcggctccttctgcatttgggggtcgctttgcatatacggccctttcacgaaaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF766 5 43.0 Weakly correlated
2 ZNF175 4 94.0 Weakly correlated
3 ZNF263 4 180.0 Weakly correlated
4 ZNF589 3 28.9 Weakly correlated
5 ZKSCAN8 2 160.0 Weakly correlated
6 ZNF197 2 99.0 Weakly correlated
7 ZNF382 2 99.0 Weakly correlated
8 ZNF394 2 99.0 Weakly correlated
9 ZNF584 2 99.0 Weakly correlated
10 ZNF597 2 94.0 Weakly correlated
11 ZFP1 1 99.0 Weakly correlated
12 ZKSCAN1 1 160.0 Weakly correlated
13 ZNF701 1 28.9 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats