ZRdb KZFP & Repeats
...

LTR_LTR45

  • Name
    LTR45
  • Repbase
    LTR45
  • Type
    LTR
  • Emergence
    99.0 Mya
  • Dfam Id
    DF0000525
Description :

LTR45 is related to the MER4 group and it has 4 bp target siteduplications.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtaaccgcgggaccagcccaaactgggcctactctgttgataacaaaatgtcgagttaccttgtaggtataacagagccnaaaactgcaagtcatgtagcccgggcatgcgcaatagaaaaagctttgacctctaacaacacccggaaccaacgattcctcccctcggaaccaagaagaccgggacatgaccggaacctgaacgccggaactctttcagaagcganggggtccgttggcccggaagatccggggctaaaatccgcctcaacataccttaccgtaaatggtcaaatttgaagccctccaatcagaccctgccaagccaacattcctaaatcctttcccttgccctccgaccccttaaaacttgccccagaccccaaatcggggagacagatttgagcccgcctcctgtctccttgctggccggttttgcaataaagcctttcttttctcaaaagccggtgccatagttattggcttctgtgcgcatcgggcagcgagcccatttgctcgataaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF680 13 28.9 Weakly correlated
2 ZNF382 9 99.0 Highly correlated
3 ZNF766 6 43.0 Weakly correlated
4 ZNF793 3 99.0 Highly correlated
5 ZFP57 3 87.0 Moderately correlated
6 ZNF92 2 28.9 Weakly correlated
7 ZIM3 2 87.0 Moderately correlated
8 ZNF263 2 180.0 Weakly correlated
9 ZNF679 2 28.9 Weakly correlated
10 ZNF394 2 99.0 Highly correlated
11 ZNF506 2 28.9 Weakly correlated
12 ZNF425 1 94.0 Moderately correlated
13 ZNF585A 1 99.0 Highly correlated
14 ZNF534 1 19.6 Weakly correlated
15 ZNF528 1 43.0 Weakly correlated
16 ZNF429 1 28.9 Weakly correlated
17 ZNF343 1 74.0 Weakly correlated
18 ZNF197 1 99.0 Highly correlated
19 ZNF140 1 99.0 Highly correlated
20 ZNF101 1 43.0 Weakly correlated
21 ZFP69B 1 99.0 Highly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF680 8 28.9 Weakly correlated
2 ZNF793 2 99.0 Highly correlated
3 ZFP57 1 87.0 Moderately correlated
4 ZNF528 1 43.0 Weakly correlated
5 ZNF534 1 19.6 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats
1 ZNF680 28.9 Weakly correlated