ZRdb KZFP & Repeats
...

LTR_LTR43B

  • Name
    LTR43B
  • Repbase
    LTR43B
  • Type
    LTR
  • Emergence
    74.0 Mya
  • Dfam Id
    DF0000522
Description :

Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgaggtaggttagatagggtggtcatagcctcccttaaaggggaacaaacttgccaaatagatggagagaacaaaccgcccgacagtgcacaaaccgcatcctgggctcgtggttagaacatcctgcagcaaggaggtagaagagcagaagggaaaatccccaaattcgcgcaagcgcagaaacccatgattagtgtccttgggctgacctntgctcattataatagtaaaaaacacacccctgggtggagatttnagatgctaatgagacatgcgatgtatgtactagcatgtacagccacagcgcatgcgcgcccaggagaccacccanaacatgcttgacagcaacgccccttcccgccccttcatgaataatcatgtaagactcccataaagggagtttccccagcgccagtcggtgctgtctcacctttgagcagccncgctctgactcagctntcagagtgtactttcgctttgcaataaacttctttgcctacttttactttggactcgctctcaaattcttttgtgcggcgaagtcaagaacctgaaccggcccaccggcaaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF766 13 43.0 Weakly correlated
2 ZNF597 12 94.0 Weakly correlated
3 ZNF382 9 99.0 Weakly correlated
4 ZKSCAN1 6 160.0 Weakly correlated
5 ZNF701 4 28.9 Weakly correlated
6 ZNF589 3 28.9 Weakly correlated
7 ZNF197 3 99.0 Weakly correlated
8 ZNF263 3 180.0 Weakly correlated
9 ZFP37 3 99.0 Weakly correlated
10 ZNF337 2 43.0 Weakly correlated
11 ZNF679 2 28.9 Weakly correlated
12 ZNF394 2 99.0 Weakly correlated
13 ZNF251 2 94.0 Weakly correlated
14 ZIM3 2 87.0 Weakly correlated
15 ZFP57 2 87.0 Weakly correlated
16 ZNF331 1 94.0 Weakly correlated
17 ZNF2 1 99.0 Weakly correlated
18 ZNF33A 1 99.0 Weakly correlated
19 ZNF274 1 99.0 Weakly correlated
20 ZNF534 1 19.6 Weakly correlated
21 ZNF558 1 99.0 Weakly correlated
22 ZNF584 1 99.0 Weakly correlated
23 ZNF175 1 94.0 Weakly correlated
24 ZNF133 1 99.0 Weakly correlated
25 ZNF101 1 43.0 Weakly correlated
26 ZNF75D 1 94.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF597 10 94.0 Weakly correlated
2 ZFP57 1 87.0 Weakly correlated
3 ZNF133 1 99.0 Weakly correlated
4 ZNF33A 1 99.0 Weakly correlated
5 ZNF75D 1 94.0 Weakly correlated
6 ZNF766 1 43.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats
1 ZNF597 94.0 Weakly correlated