ZRdb KZFP & Repeats
...

LTR_LTR38C

  • Name
    LTR38C
  • Repbase
    LTR38C
  • Type
    LTR
  • Emergence
    74.0 Mya
  • Dfam Id
    DF0000505
Description :

Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtaaccgagcagcttagcctcaaaccgcgttttaaaacttttttttcttttcccttcctttctccccagtctcaagatataactttgagacaaactgcatatgtgtttcctttcgtcttgaaatacagcctcggaatgtgctgtgaacctccactccctttcctttcccattctatgctcccatgccttatgcacatttatttacctagatgcttgttaagcacacaccatgctcacttatctggtcatatatttccttagaagcttcaggggccggatcctgatacggaccagacacctccggaattctctctccagcaaaagattacttcaaggccggaacccactcccggctagagattgactgcaagattgactgcgattaatttgtaacctggtngggcccacgatggcgccggccccttcaccagatggaacaataattcaagacgagccatcggagcgggtcacgccacctggcacctcctagccccccttgcctcttctgcattccaaacccctctctctttaaaaacccctgcgttccctccacaaattgaagagtggnaatttttggaaagaattnccgcccactcttccccttgctagcacggataataaaattcgctctctttttatcacacctcgctcttgttattttggcttctttctacaagcggcgagcagccggacccttttcgccggttaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF382 2 99.0 Weakly correlated
2 ZIM3 1 87.0 Weakly correlated
3 ZNF251 1 94.0 Weakly correlated
4 ZNF263 1 180.0 Weakly correlated
5 ZNF317 1 99.0 Weakly correlated
6 ZNF425 1 94.0 Weakly correlated
7 ZNF485 1 94.0 Weakly correlated
8 ZNF534 1 19.6 Weakly correlated
9 ZNF679 1 28.9 Weakly correlated
10 ZNF723 1 15.2 Weakly correlated
11 ZNF735 1 28.9 Weakly correlated
12 ZNF766 1 43.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZIM3 1 87.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats