ZRdb KZFP & Repeats
...

LTR_LTR38A1

  • Name
    LTR38A1
  • Repbase
    LTR38A1
  • Type
    LTR
  • Emergence
    74.0 Mya
  • Dfam Id
    DF0000503
Description :

Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtaaccggggacctcagttttaaaaatatattttaatcacccactttctttttcttccttccctcccctctcaccccttcattccttccctctctagacactcccctccggcaatgcatgcttatctaattatgctcttgcttaagaaattccagaggctaatcttgaaacaaaccaggcacggagccccgattgcggaatcctcccgcttagggggagtcgcgaacaattagtccaccaccatcgggccgaagtcaagataacgccaaccagacctccggacgggcgattacccaagatagccatcggaacaaagacacacagaccctgcaccctgcaccactcccgcatgtctcccataccaagtttccctttaaaaaccctatggtaaattttaaaatttaagatggtactttagaacgctagttcgccatcttctcggtttgctggctctccgattaaacctgcttttcctcccaccaaccctcgcctctcgtgtttggctttcgagcggcgagcagccgaacctgggtccggttaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF799 6 43.0 Weakly correlated
2 ZNF257 4 0.0 Weakly correlated
3 ZNF479 4 6.4 Weakly correlated
4 ZNF554 4 99.0 Weakly correlated
5 ZNF490 3 43.0 Weakly correlated
6 ZNF766 3 43.0 Weakly correlated
7 ZNF175 2 94.0 Weakly correlated
8 ZNF197 2 99.0 Weakly correlated
9 ZNF382 2 99.0 Weakly correlated
10 ZNF701 2 28.9 Weakly correlated
11 ZNF680 2 28.9 Weakly correlated
12 ZNF845 1 28.9 Weakly correlated
13 ZFP69B 1 99.0 Weakly correlated
14 ZNF808 1 19.6 Weakly correlated
15 ZNF674 1 99.0 Weakly correlated
16 ZNF610 1 28.9 Weakly correlated
17 ZNF607 1 43.0 Weakly correlated
18 ZNF589 1 28.9 Weakly correlated
19 ZNF584 1 99.0 Weakly correlated
20 ZNF506 1 28.9 Weakly correlated
21 ZNF30 1 94.0 Weakly correlated
22 ZNF263 1 180.0 Weakly correlated
23 ZKSCAN1 1 160.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF799 2 43.0 Weakly correlated
2 ZNF479 2 6.4 Weakly correlated
3 ZNF490 1 43.0 Weakly correlated
4 ZNF175 1 94.0 Weakly correlated
5 ZNF589 1 28.9 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats