ZRdb KZFP & Repeats
...

LTR_LTR3

  • Name
    LTR3
  • Repbase
    LTR3
  • Type
    LTR
  • Emergence
    28.9 Mya
  • Dfam Id
    DF0000689
Description :

6 bp TSD.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtngggagccgaaagcctgagggtcgtgaccaactcagcattccactggaggctatatgatcaaacagcaaactgtttatcatgaatgcaggatgtgggcaaactcgcgtctgcgcctgccgccagaaggtntgctgagggcaatcactccctggcgccgtgctccttgaggttatctactggaacatctggagcctactgttcaaagaatgcagtcgtgcaggcctgcactaagtcaagcagctgaccgacaaccaccccccttctccctatctcctttactcaataaatacgaagggctctagaagctcagggcccttgttcactagaagcaaggagccccctgaccccttcttccaaatatactcttttgtctttgtctttattcccgcgttcgtcctcctttgttcagtccancagggtccgcggca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF175 17 94.0 Weakly correlated
2 ZNF589 16 28.9 Highly correlated
3 ZKSCAN8 15 160.0 Weakly correlated
4 ZNF766 15 43.0 Weakly correlated
5 ZNF584 10 99.0 Weakly correlated
6 ZNF701 10 28.9 Highly correlated
7 ZNF197 9 99.0 Weakly correlated
8 ZKSCAN1 8 160.0 Weakly correlated
9 ZNF274 6 99.0 Weakly correlated
10 ZNF18 5 160.0 Weakly correlated
11 ZNF679 5 28.9 Highly correlated
12 ZNF28 4 28.9 Highly correlated
13 ZNF382 4 99.0 Weakly correlated
14 ZFP37 4 99.0 Weakly correlated
15 ZNF2 2 99.0 Weakly correlated
16 ZNF263 2 180.0 Weakly correlated
17 ZNF534 2 19.6 Moderately correlated
18 ZNF8 2 99.0 Weakly correlated
19 ZNF792 1 94.0 Weakly correlated
20 ZNF92 1 28.9 Highly correlated
21 ZNF439 1 8.6 Weakly correlated
22 ZNF417 1 28.9 Highly correlated
23 ZNF394 1 99.0 Weakly correlated
24 ZNF324 1 99.0 Weakly correlated
25 ZNF133 1 99.0 Weakly correlated
26 ZFP57 1 87.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF701 5 28.9 Highly correlated
2 ZNF679 3 28.9 Highly correlated
3 ZNF589 2 28.9 Highly correlated
4 ZFP57 1 87.0 Weakly correlated
5 ZNF274 1 99.0 Weakly correlated
6 ZNF175 1 94.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats