ZRdb KZFP & Repeats
...

LTR_LTR27B

  • Name
    LTR27B
  • Repbase
    LTR27B
  • Type
    LTR
  • Emergence
    43.0 Mya
  • Dfam Id
    DF0000476
Description :

Subfamily is closely related to LTR28. Therefore, LTR27, LTR27B andLTR28 should be treated as subfamilies of the same family. More distantrelation to: LTR1, MER52, MER61, LTR20 and LTR25.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgatagcgacaggaggcagccaaatgcctaggcagataggggcgggtccccggtgaaaccccaccttcaagccaaaaancagcctgaaggctgaaagaccggactgctggtcccggatgaaacccgcgacccagagtgagaacttctgttcctgtttgcccgccctttcccgattgattctttctgaataatgccttttaaccaatcgaatgttgccttttccaatactacctacggcctgcccctcccccattctgagcccataaaagccccggactcagccacattggggggactttcccgccttcgggtagggggaccacccccgcgtcccctctccgctgaaagctgttttcatcactcaataaaattctcctccgccttgctcactcttcgattgtcagcgtatcctcattcttcttgggcgcgggacaagaactcggganccagtgcgcaagccagactcggcccgggcgggccgagtgggcgggccgtctcctgcagcaggtagcgtggccgagcgaggcccgggcggggcgtcgccggccggaggtccccggcttgcaaagtgaccgagaagaaaatcctgcgtca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF680 401 28.9 Moderately correlated
2 ZNF736 39 43.0 Highly correlated
3 ZNF486 27 8.6 Weakly correlated
4 ZNF75D 26 94.0 Weakly correlated
5 ZNF141 8 43.0 Highly correlated
6 ZNF28 6 28.9 Moderately correlated
7 ZNF597 6 94.0 Weakly correlated
8 ZNF263 5 180.0 Weakly correlated
9 ZNF257 4 0.0 Weakly correlated
10 ZNF382 4 99.0 Weakly correlated
11 ZNF317 3 99.0 Weakly correlated
12 ZNF479 3 6.4 Weakly correlated
13 ZNF534 3 19.6 Weakly correlated
14 ZNF18 2 160.0 Weakly correlated
15 ZNF251 2 94.0 Weakly correlated
16 ZNF140 2 99.0 Weakly correlated
17 ZNF506 2 28.9 Moderately correlated
18 ZNF554 2 99.0 Weakly correlated
19 ZFP57 1 87.0 Weakly correlated
20 ZNF705B 1 28.9 Moderately correlated
21 ZNF707 1 74.0 Weakly correlated
22 ZNF780A 1 43.0 Highly correlated
23 ZNF786 1 99.0 Weakly correlated
24 ZNF766 1 43.0 Highly correlated
25 ZNF679 1 28.9 Moderately correlated
26 ZNF616 1 43.0 Highly correlated
27 ZNF547 1 74.0 Weakly correlated
28 ZNF445 1 99.0 Weakly correlated
29 ZNF320 1 28.9 Moderately correlated
30 ZNF182 1 99.0 Weakly correlated
31 ZKSCAN1 1 160.0 Weakly correlated
32 ZIM3 1 87.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF680 70 28.9 Moderately correlated
2 ZNF736 36 43.0 Highly correlated
3 ZNF75D 13 94.0 Weakly correlated
4 ZNF141 8 43.0 Highly correlated
5 ZNF597 5 94.0 Weakly correlated
6 ZNF28 5 28.9 Moderately correlated
7 ZIM3 1 87.0 Weakly correlated
8 ZNF251 1 94.0 Weakly correlated
9 ZNF479 1 6.4 Weakly correlated
10 ZNF534 1 19.6 Weakly correlated
11 ZNF320 1 28.9 Moderately correlated
12 ZNF780A 1 43.0 Highly correlated
13 ZNF486 1 8.6 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats
1 ZNF75D 94.0 Weakly correlated