ZRdb KZFP & Repeats
...

LTR_LTR26B

  • Name
    LTR26B
  • Repbase
    LTR26B
  • Type
    LTR
  • Emergence
    74.0 Mya
  • Dfam Id
    DF0000470
Description :

Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgaagccgtcctcacagggttaacaagaattctggacagaaatatagttataattaagcattaatcaggctgcactttgacccacttccttgtaaccgaaagtcacgtagcactagatactgaccatttgcatccccattgttcctatagataggatttctgacgttagaatcataaggcttttgtttaagaattgcttaagcagatcctgaattccagcggaacagctgacgccaaccagtttgaagacccccacagaggaaccgaatcagcatgagaatacagtttcttcatctccctgtcccatgacttcaccctgcactcttcgaccaatcaacgatctccacacttcggcccactccaaaacccttaaaaaccctagccccaaactcctcggggagacggatttgaggtttcctcccgtctcctcgttcggcggccctacgattaaacctctttctctgctgcaacccggtgtctcggcgtattgacttgccgcgcgcatcgggcaacggacctattacggttaca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF766 17 43.0 Weakly correlated
2 ZNF317 5 99.0 Weakly correlated
3 ZNF823 3 43.0 Weakly correlated
4 ZNF382 3 99.0 Weakly correlated
5 ZNF808 2 19.6 Weakly correlated
6 ZNF394 2 99.0 Weakly correlated
7 ZFP37 2 99.0 Weakly correlated
8 ZNF441 1 43.0 Weakly correlated
9 ZNF92 1 28.9 Weakly correlated
10 ZNF780A 1 43.0 Weakly correlated
11 ZNF700 1 28.9 Weakly correlated
12 ZNF597 1 94.0 Weakly correlated
13 ZNF479 1 6.4 Weakly correlated
14 ZNF324 1 99.0 Weakly correlated
15 ZNF2 1 99.0 Weakly correlated
16 ZNF263 1 180.0 Weakly correlated
17 ZNF18 1 160.0 Weakly correlated
18 ZIM3 1 87.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF766 11 43.0 Weakly correlated
2 ZNF823 3 43.0 Weakly correlated
3 ZNF441 1 43.0 Weakly correlated
4 ZNF317 1 99.0 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats