ZRdb KZFP & Repeats
...

LTR_LTR22E

  • Name
    LTR22E
  • Repbase
    LTR22E
  • Type
    LTR
  • Emergence
    28.9 Mya
  • Dfam Id
    DF0000461
Description :

Present in baboon & rhesus, absent from marmoset.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtaggnagatcggtcagggtggtgggaaaagttataagaaaaagttatagggaaagacgcaaaccttcttggaaggccgggaggttttgcaaaagcttcgggaagagaatttggctgaaggcagccaaattctcttatccggagnctgagagcaaagggtagataacaagggaatgtaaaggaacttatctagataaatttgtttactcctgtcgtccagaaaccaacctttgatcattcgcgcgcaggactgctctctactcggggggtcgacaatgtttattacccacaaattgtgtttgctccaagcctttgtcattaaatctgtactaaataaatgcgagcgncgccggcttatgggggctgcactctcttngcggctgcngcactctcgtcggcggtgctgagccgtgcggtcccctagcccgcgctgtcaggcaaaatacctgtgtcagcgtacttctttcatccgtcgctcggccagagtctgcgggacagactcggca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF253 37 19.6 Moderately correlated
2 ZNF486 26 8.6 Weakly correlated
3 ZNF91 12 6.0 Weakly correlated
4 ZNF382 6 99.0 Weakly correlated
5 ZNF845 5 28.9 Highly correlated
6 ZNF534 5 19.6 Moderately correlated
7 ZNF766 4 43.0 Weakly correlated
8 ZNF701 4 28.9 Highly correlated
9 ZNF317 3 99.0 Weakly correlated
10 ZNF274 2 99.0 Weakly correlated
11 ZNF589 2 28.9 Highly correlated
12 ZNF554 1 99.0 Weakly correlated
13 ZFP37 1 99.0 Weakly correlated
14 ZNF786 1 99.0 Weakly correlated
15 ZNF778 1 74.0 Weakly correlated
16 ZNF680 1 28.9 Highly correlated
17 ZNF585A 1 99.0 Weakly correlated
18 ZNF251 1 94.0 Weakly correlated
19 ZNF175 1 94.0 Weakly correlated
20 ZNF485 1 94.0 Weakly correlated
21 ZNF394 1 99.0 Weakly correlated
22 ZNF28 1 28.9 Highly correlated
23 ZNF263 1 180.0 Weakly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF253 39 19.6 Moderately correlated
2 ZNF701 4 28.9 Highly correlated
3 ZNF534 4 19.6 Moderately correlated
4 ZNF680 1 28.9 Highly correlated
5 ZNF766 1 43.0 Weakly correlated
6 ZNF263 1 180.0 Weakly correlated
7 ZNF486 1 8.6 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats