ZRdb KZFP & Repeats
...

LTR_LTR22C2

  • Name
    LTR22C2
  • Repbase
    LTR22C2
  • Type
    LTR
  • Emergence
    28.9 Mya
  • Dfam Id
    DF0000460
Description :

Present in baboon & rhesus, absent from marmoset.
Consensus sequence The consensus sequences obtained from Dfam are derived from the seed alignment using a specialized caller. :
tgtgggagttcagtcagggtggtgggagaaattataagatgataggaaaaagcaaaccttcttggaaggccgggaggttttgcatagcttcagatagatttggctgaaggcagccnaatcctcttttcaggagctaganagcttagggcgcagatacaaaggaatgtaggggagtttatctaaatagcttgtttactcatgtggtcctaagaccaacctttgatcattcgcgggcaggacggctctctccggggngggggcgaccaggttaattacccacaggtgtgttgactcaaagcctttgtcanttaaatctgtgctgaataaatgccggcagggccagctagtcggggccgcggctgcnaactctttacagcnccttccttggtgtctgtgagcggcccggccccctagccggactctttcactgaatatcggtgtctgagtacgttattcatccgtcgtgcagccggggtctgcgggacagacccccgca
Repeats structure For certain families, there exists a curated collection of TE-derived proteins, which constitutes a non-redundant set. As a results, several families may lack an associated coding sequences directly linked to them. The annotation for these families is obtained from Dfam. :
...
Peak overlapping A ChIP-seq peak of KZFPs that intersects with a certain repeats sequence on the genome. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF253 20 19.6 Moderately correlated
2 ZNF486 19 8.6 Weakly correlated
3 ZNF91 7 6.0 Weakly correlated
4 ZNF679 3 28.9 Highly correlated
5 ZNF133 1 99.0 Weakly correlated
6 ZNF257 1 0.0 Weakly correlated
7 ZNF264 1 99.0 Weakly correlated
8 ZNF317 1 99.0 Weakly correlated
9 ZNF554 1 99.0 Weakly correlated
10 ZNF723 1 15.2 Moderately correlated
11 ZNF92 1 28.9 Highly correlated
KZFPs Motif in Repeats The motif of KZFPs found by the meme-chip appears in the repeats sequence. :
# KZFP name Record number KZFP age(Mya) Time correlation with Repeats
1 ZNF253 18 19.6 Moderately correlated
2 ZNF486 4 8.6 Weakly correlated
KZFPs Motif in Repeats Consensus The motif of KZFPs found by the meme-chip can find the corresponding region on the consensus sequence of repeats. :
# KZFP name KZFP age(Mya) Time correlation with Repeats